ID: 921405449

View in Genome Browser
Species Human (GRCh38)
Location 1:214774652-214774674
Sequence AAAGATTTATTCCGAAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405449_921405456 29 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data
921405449_921405455 24 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405455 1:214774699-214774721 ATTTTCTCTTTTAGGAAACAGGG No data
921405449_921405454 23 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405454 1:214774698-214774720 AATTTTCTCTTTTAGGAAACAGG No data
921405449_921405453 16 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405453 1:214774691-214774713 CTCATTAAATTTTCTCTTTTAGG No data
921405449_921405457 30 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405457 1:214774705-214774727 TCTTTTAGGAAACAGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405449 Original CRISPR AAAGATTTATTCCGAAGTTG AGG (reversed) Intergenic