ID: 921405451

View in Genome Browser
Species Human (GRCh38)
Location 1:214774676-214774698
Sequence TTAATGAGTTCTGCCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405451_921405456 5 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data
921405451_921405458 9 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405458 1:214774708-214774730 TTTAGGAAACAGGGCTTGGGAGG No data
921405451_921405457 6 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405457 1:214774705-214774727 TCTTTTAGGAAACAGGGCTTGGG No data
921405451_921405454 -1 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405454 1:214774698-214774720 AATTTTCTCTTTTAGGAAACAGG No data
921405451_921405455 0 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405455 1:214774699-214774721 ATTTTCTCTTTTAGGAAACAGGG No data
921405451_921405453 -8 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405453 1:214774691-214774713 CTCATTAAATTTTCTCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405451 Original CRISPR TTAATGAGTTCTGCCTAAGG AGG (reversed) Intergenic
No off target data available for this crispr