ID: 921405452

View in Genome Browser
Species Human (GRCh38)
Location 1:214774679-214774701
Sequence AATTTAATGAGTTCTGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405452_921405458 6 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405458 1:214774708-214774730 TTTAGGAAACAGGGCTTGGGAGG No data
921405452_921405456 2 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data
921405452_921405455 -3 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405455 1:214774699-214774721 ATTTTCTCTTTTAGGAAACAGGG No data
921405452_921405457 3 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405457 1:214774705-214774727 TCTTTTAGGAAACAGGGCTTGGG No data
921405452_921405454 -4 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405454 1:214774698-214774720 AATTTTCTCTTTTAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405452 Original CRISPR AATTTAATGAGTTCTGCCTA AGG (reversed) Intergenic