ID: 921405453

View in Genome Browser
Species Human (GRCh38)
Location 1:214774691-214774713
Sequence CTCATTAAATTTTCTCTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405449_921405453 16 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405453 1:214774691-214774713 CTCATTAAATTTTCTCTTTTAGG No data
921405451_921405453 -8 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405453 1:214774691-214774713 CTCATTAAATTTTCTCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405453 Original CRISPR CTCATTAAATTTTCTCTTTT AGG Intergenic