ID: 921405456

View in Genome Browser
Species Human (GRCh38)
Location 1:214774704-214774726
Sequence CTCTTTTAGGAAACAGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405452_921405456 2 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data
921405451_921405456 5 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data
921405449_921405456 29 Left 921405449 1:214774652-214774674 CCTCAACTTCGGAATAAATCTTT No data
Right 921405456 1:214774704-214774726 CTCTTTTAGGAAACAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405456 Original CRISPR CTCTTTTAGGAAACAGGGCT TGG Intergenic