ID: 921405458

View in Genome Browser
Species Human (GRCh38)
Location 1:214774708-214774730
Sequence TTTAGGAAACAGGGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921405451_921405458 9 Left 921405451 1:214774676-214774698 CCTCCTTAGGCAGAACTCATTAA No data
Right 921405458 1:214774708-214774730 TTTAGGAAACAGGGCTTGGGAGG No data
921405452_921405458 6 Left 921405452 1:214774679-214774701 CCTTAGGCAGAACTCATTAAATT No data
Right 921405458 1:214774708-214774730 TTTAGGAAACAGGGCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921405458 Original CRISPR TTTAGGAAACAGGGCTTGGG AGG Intergenic