ID: 921407828

View in Genome Browser
Species Human (GRCh38)
Location 1:214800053-214800075
Sequence CTGTGGGTCATGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921407820_921407828 16 Left 921407820 1:214800014-214800036 CCATCCCAGGAAGTTCTCAAATC No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407818_921407828 18 Left 921407818 1:214800012-214800034 CCCCATCCCAGGAAGTTCTCAAA No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407815_921407828 28 Left 921407815 1:214800002-214800024 CCACCCAGTTCCCCATCCCAGGA No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407825_921407828 -8 Left 921407825 1:214800038-214800060 CCACGTATAGCATTGCTGTGGGT No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407821_921407828 12 Left 921407821 1:214800018-214800040 CCCAGGAAGTTCTCAAATCACCA No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407819_921407828 17 Left 921407819 1:214800013-214800035 CCCATCCCAGGAAGTTCTCAAAT No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407816_921407828 25 Left 921407816 1:214800005-214800027 CCCAGTTCCCCATCCCAGGAAGT No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407822_921407828 11 Left 921407822 1:214800019-214800041 CCAGGAAGTTCTCAAATCACCAC No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data
921407817_921407828 24 Left 921407817 1:214800006-214800028 CCAGTTCCCCATCCCAGGAAGTT No data
Right 921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921407828 Original CRISPR CTGTGGGTCATGAGGGCAGA AGG Intergenic
No off target data available for this crispr