ID: 921411352

View in Genome Browser
Species Human (GRCh38)
Location 1:214839557-214839579
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921411348_921411352 13 Left 921411348 1:214839521-214839543 CCTACAAAAGGAGGAAGAGCAGT No data
Right 921411352 1:214839557-214839579 AATAAAGCTGCAGCCGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr