ID: 921418584

View in Genome Browser
Species Human (GRCh38)
Location 1:214919808-214919830
Sequence ATGGAGAAGGAGAATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921418584_921418590 5 Left 921418584 1:214919808-214919830 CCTTCCTGATTCTCCTTCTCCAT No data
Right 921418590 1:214919836-214919858 TGGCTTCTCCAGCCCCTGAGAGG No data
921418584_921418591 6 Left 921418584 1:214919808-214919830 CCTTCCTGATTCTCCTTCTCCAT No data
Right 921418591 1:214919837-214919859 GGCTTCTCCAGCCCCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921418584 Original CRISPR ATGGAGAAGGAGAATCAGGA AGG (reversed) Intergenic
No off target data available for this crispr