ID: 921424377

View in Genome Browser
Species Human (GRCh38)
Location 1:214985028-214985050
Sequence CCCATTATGGACTCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921424377_921424385 6 Left 921424377 1:214985028-214985050 CCCCACACAGAGTCCATAATGGG No data
Right 921424385 1:214985057-214985079 CCCAGTGGAGATGTGAGAAGAGG No data
921424377_921424383 -9 Left 921424377 1:214985028-214985050 CCCCACACAGAGTCCATAATGGG No data
Right 921424383 1:214985042-214985064 CATAATGGGGCACTGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921424377 Original CRISPR CCCATTATGGACTCTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr