ID: 921429706

View in Genome Browser
Species Human (GRCh38)
Location 1:215051253-215051275
Sequence AATTTTATGTGGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921429702_921429706 4 Left 921429702 1:215051226-215051248 CCACCATGCATGGATCTTAATAT 0: 1
1: 0
2: 0
3: 17
4: 248
Right 921429706 1:215051253-215051275 AATTTTATGTGGAAGATGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 386
921429703_921429706 1 Left 921429703 1:215051229-215051251 CCATGCATGGATCTTAATATTAA 0: 1
1: 0
2: 1
3: 15
4: 228
Right 921429706 1:215051253-215051275 AATTTTATGTGGAAGATGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921429706 Original CRISPR AATTTTATGTGGAAGATGGA AGG Intronic
900829098 1:4951369-4951391 CATTTTATTGGGAAGATTGATGG - Intergenic
901092139 1:6648983-6649005 AATTTTTTTTAAAAGATGGAAGG - Intronic
902377729 1:16037726-16037748 AGTTGGATGTGGAAGATGGAGGG + Intergenic
903824247 1:26131226-26131248 ACTTTTTTGTGAAAGGTGGATGG - Intergenic
903875254 1:26469524-26469546 AATCTTTTGTGGAAGCTGGGTGG - Exonic
904289498 1:29475153-29475175 AATTTTATGTGTCAGTTTGAAGG - Intergenic
904309200 1:29615358-29615380 GAATTTATGTGAAAGATGTAAGG + Intergenic
907522848 1:55036156-55036178 ACTTTTGTGTGGAAGCTGCATGG + Intergenic
908676981 1:66615615-66615637 ATTTTCTTGTGGAAAATGGAGGG + Intronic
908692494 1:66798208-66798230 ACGTTTATGTGGGAGCTGGAAGG + Exonic
908890740 1:68844673-68844695 AATTTGAGGTGCAAGATGAAAGG + Intergenic
908905338 1:69002067-69002089 AATTTTATGAAGCAGAAGGAGGG - Intergenic
909654272 1:78013166-78013188 AATTTTCTTTGGAAGACGAATGG + Exonic
909876127 1:80805990-80806012 AGTTTTATCTGGAGGATGGGAGG - Intergenic
910535539 1:88293508-88293530 AAATTTATGTGGAAAAAGGTTGG + Intergenic
910837282 1:91528507-91528529 CATTTTATGGGGAAGTTGGGTGG - Intergenic
911169347 1:94754946-94754968 TATTTTATATGCAAGAGGGAAGG - Intergenic
911481859 1:98452962-98452984 AATTGTATGTGAAAGACAGAGGG + Intergenic
911547475 1:99236457-99236479 ACTGTTCTGTGAAAGATGGATGG - Intergenic
911946835 1:104121680-104121702 AATTTCATGTGTAATTTGGAAGG + Intergenic
912015689 1:105032480-105032502 AACCTTTTGTGCAAGATGGAAGG - Intergenic
912076273 1:105880000-105880022 AATTTTTTGTGTAAGGTGTAAGG + Intergenic
914879403 1:151535976-151535998 TATCTGAGGTGGAAGATGGAGGG - Intronic
918406523 1:184216431-184216453 AATTTTATATGGAAGAGCAATGG + Intergenic
919141893 1:193582744-193582766 GTATTTATGTGGAAGAAGGAAGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
919477139 1:198042925-198042947 ATTTTTTTCTGGAAAATGGAGGG + Intergenic
920549437 1:206846204-206846226 AATTTGCTCTGGAAGATGGAAGG - Intergenic
920990903 1:210938503-210938525 AATTTTATCTAGAAGACAGAGGG - Intronic
921429706 1:215051253-215051275 AATTTTATGTGGAAGATGGAAGG + Intronic
921610266 1:217205599-217205621 CATTTTATGTGGATGGTGGCAGG - Intergenic
921640277 1:217544786-217544808 TATTTTATTTGTAAGATAGAAGG - Intronic
923797280 1:237170042-237170064 AGTTTATTTTGGAAGATGGAGGG + Intronic
923808124 1:237282923-237282945 AACTTTATTTGAAAGATGAAGGG + Intronic
924944380 1:248836544-248836566 AATTGTAACAGGAAGATGGAGGG - Intergenic
1062782075 10:221829-221851 TATTTTATTTGGAGGGTGGAGGG + Intronic
1063586094 10:7353771-7353793 AATTTTAAATGTAGGATGGAAGG - Intronic
1063933094 10:11049427-11049449 CATTTTATGTCGAAAATAGATGG + Intronic
1064684184 10:17842482-17842504 ATTTTTTTCTGGAACATGGAAGG + Intronic
1066077968 10:31899697-31899719 AATTTTTTGTGAAAGGTGTAAGG - Intronic
1066517321 10:36177461-36177483 AATTATATGAGGAGGAGGGAGGG - Intergenic
1066567784 10:36738272-36738294 AATTTTATGTTAAAGATGGCCGG + Intergenic
1066646965 10:37619849-37619871 AATTTTATAGGGAAGAAGGTGGG + Intergenic
1066669657 10:37823489-37823511 AATTTTATGTGAAATAATGAGGG + Intronic
1066762284 10:38766867-38766889 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1066792567 10:39081978-39082000 AATTCCATGTGGCAGATGGATGG - Intergenic
1066959306 10:42205603-42205625 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1068175403 10:53450334-53450356 AATTTAATGTGGATGTTGTAGGG + Intergenic
1068340878 10:55700515-55700537 AATTTTATGAGTAATATAGACGG - Intergenic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1069051638 10:63801301-63801323 AATGTTAAGTGGAAAATGCAAGG - Intergenic
1070862063 10:79678467-79678489 CACTTTATGTGGAAGATAAAAGG + Intergenic
1070875072 10:79795986-79796008 CACTTTATGTGGAAGATAAAAGG - Intergenic
1071018811 10:81028697-81028719 CATCTTATGTGGATGATGGCAGG + Intergenic
1071641999 10:87318156-87318178 CACTTTATGTGGAAGATAAAAGG - Intergenic
1073305322 10:102499001-102499023 AATTTAATGAGGAAAATGGAGGG - Intronic
1073855057 10:107664047-107664069 CATTTTATGTGGATGATGGCAGG + Intergenic
1074309878 10:112312937-112312959 GATTTTATTAGGAGGATGGAGGG - Intergenic
1074929086 10:118105263-118105285 CATTAAATGTTGAAGATGGAAGG + Intergenic
1075308903 10:121394740-121394762 AATTTTGAGAGGAAAATGGAGGG - Intergenic
1076180569 10:128404312-128404334 AATTATTTGTGGAACATAGAAGG - Intergenic
1077698077 11:4413315-4413337 AATTTTAAGTGACAGATGGGTGG - Intergenic
1077934322 11:6767960-6767982 AATTTTATCTGGAGGAGGAATGG + Intergenic
1078113536 11:8421580-8421602 AAATTTATGTGGAAGACTAAAGG - Intronic
1078212679 11:9283443-9283465 AGTTTTTTTTGGAAGATGGCTGG + Exonic
1078588918 11:12620813-12620835 GATTTGGTGTGGAAGGTGGATGG + Intergenic
1079581196 11:22066710-22066732 AACTTTGTGTGTCAGATGGAAGG - Intergenic
1080002583 11:27366795-27366817 AATAGTATGGGGAAGATGTATGG + Exonic
1085718389 11:78892665-78892687 AATAATATGTGGTAGATGTAGGG - Intronic
1086079719 11:82890590-82890612 AATATGGTGTGGTAGATGGAGGG - Intronic
1086360199 11:86050541-86050563 AATTTAATTTGCATGATGGAAGG - Intronic
1087043761 11:93827058-93827080 AATTATATGTGATAGATTGATGG - Intronic
1088400295 11:109416204-109416226 TTTTTGATGTTGAAGATGGAGGG - Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088878569 11:113956089-113956111 AACTTTATATGTAAGAGGGAGGG + Intergenic
1090534893 11:127630350-127630372 AATTTTATGTGGAATTTGGGTGG + Intergenic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091162356 11:133436478-133436500 AATTTTAAGTGAAAGATGAGCGG - Intronic
1091297642 11:134485313-134485335 AATTCTTTGGGGAAGAAGGAAGG - Intergenic
1091513185 12:1151301-1151323 AATTTATTGGGGAAGAGGGAAGG + Intronic
1091685581 12:2559297-2559319 AATATGATCTGGAGGATGGAAGG + Intronic
1092701905 12:11241210-11241232 CATTTTAGATGGAAGGTGGATGG + Intergenic
1093138647 12:15480708-15480730 AAGCTGATGTAGAAGATGGATGG + Intronic
1093264266 12:16983081-16983103 AATTTTATGTGTCAAGTGGATGG - Intergenic
1093556656 12:20483827-20483849 AATTTTATCTGGAAGATAAAAGG - Intronic
1094356690 12:29585608-29585630 AATTTTTTGTATAAGATGTAAGG + Intronic
1095356028 12:41276232-41276254 AATTTCATATGGAAGGTGGTGGG + Intronic
1096543030 12:52318915-52318937 AAGTTTTTGTGAAAAATGGATGG + Intronic
1096568849 12:52506942-52506964 ATTTTTTTGTTGAAAATGGATGG + Intergenic
1097131977 12:56818270-56818292 AGTTTTATGTGGAACACGCAGGG + Intergenic
1098777393 12:74637945-74637967 AAATTAATGTAGAAAATGGAAGG + Intergenic
1099001784 12:77186738-77186760 TATTTTATGTGGCAAGTGGATGG + Intergenic
1099350364 12:81560358-81560380 AACTATATGTGAAAGGTGGAAGG + Intronic
1099494753 12:83333476-83333498 AATAATATTTGTAAGATGGAAGG - Intergenic
1101057228 12:100930648-100930670 AACTTTCTGTGGCAGAAGGAAGG + Intronic
1101575114 12:105990168-105990190 AATTAAATGTGGTAGAGGGAAGG - Intergenic
1101713224 12:107288104-107288126 AACGTTATTTGGAAGAAGGAAGG - Intergenic
1102442440 12:112974063-112974085 AATTTTATGTGTCTGCTGGACGG - Intergenic
1104497427 12:129254066-129254088 AATTTACTGTGGGAGATGCAGGG + Intronic
1105948765 13:25211548-25211570 AACTATATTTGGAAAATGGACGG + Intergenic
1107343168 13:39431733-39431755 AATTTGATGTGGAATATGAGAGG - Intronic
1108278463 13:48836234-48836256 AATTTTATGTGGAACAACTAAGG - Intergenic
1108278584 13:48838127-48838149 GATATTATGTGGCAGAAGGATGG + Intergenic
1109040884 13:57334584-57334606 AATTTTAGATGGAAGTTGGGGGG - Intergenic
1109280040 13:60345291-60345313 AATATTATGTGGAATAAGGCTGG + Intergenic
1109331172 13:60932732-60932754 AATTCTATGTGGAAGAGATATGG - Intergenic
1109468366 13:62769368-62769390 AGTTTTATGTGAAAACTGGATGG + Intergenic
1109925041 13:69126280-69126302 AATCTTATGTGGCAGACGGTTGG + Intergenic
1110900349 13:80814775-80814797 AATTGTCTGTGGAGGATGGGTGG + Intergenic
1111045784 13:82811857-82811879 CATTTTATGTGGAAGTTGGCAGG - Intergenic
1111194512 13:84856166-84856188 AATTTAATGTTGGAGAGGGAAGG - Intergenic
1111549938 13:89795127-89795149 AATTTTTTGTGTAAGGTGTAAGG + Intergenic
1111836389 13:93393687-93393709 AATTCTAGGTGGAAAATTGAGGG - Intronic
1113046502 13:106160957-106160979 AATTTAATATGTAAGATAGAGGG + Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1113868169 13:113542822-113542844 AATTTTATGTGGAAATTTGAAGG + Intronic
1114920643 14:27323781-27323803 AGTTTTTTGTGAAAGATGTAAGG + Intergenic
1115110047 14:29810877-29810899 AAATTAAAGTGGAAGATGCAAGG + Intronic
1115215431 14:31009322-31009344 TATTTTATTTGGGACATGGAGGG + Intronic
1116598398 14:46884722-46884744 AATTTTATGTATAAGATATAAGG - Intronic
1117745306 14:58863220-58863242 AAGAATAAGTGGAAGATGGATGG - Intergenic
1118432929 14:65739886-65739908 AATTTTATGGGGATGCTGAAAGG + Intronic
1118631520 14:67708484-67708506 AATTGTCTGTGGATGATGAAAGG + Intronic
1118980264 14:70710484-70710506 AAATTTATGTGGAAGGAGGTAGG + Intergenic
1119447193 14:74675670-74675692 GATTTTATGTCGAGAATGGAAGG + Intronic
1120336143 14:83157867-83157889 AATTTTATCAGGAAAATGCAAGG + Intergenic
1120363034 14:83530283-83530305 AACTTAATGTAGAAGATAGAGGG - Intergenic
1120431577 14:84424198-84424220 AATTTTATATGGAAGAGTAAAGG + Intergenic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1121804734 14:96807597-96807619 AAAATTATGTAGAAGAAGGAAGG - Intronic
1123157471 14:106242500-106242522 AAACTTATGTGGAAGATTGTAGG - Intergenic
1123188769 14:106546876-106546898 AAACTTATGTGGAAGATTGTGGG - Intergenic
1202933617 14_KI270725v1_random:63120-63142 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1124915148 15:33963089-33963111 AATTTATTGTGTAAAATGGATGG + Intronic
1125009410 15:34854684-34854706 AAATTTAGGTGGAAGATGGATGG - Exonic
1125024348 15:35015697-35015719 AACTTTATTTAGAAGAGGGAAGG + Intergenic
1127387069 15:58475259-58475281 ATTATGGTGTGGAAGATGGAGGG - Intronic
1128817031 15:70617882-70617904 TATTTTCTTTGCAAGATGGAAGG + Intergenic
1129311235 15:74710789-74710811 AATTTCATCTGGAAAATGGGGGG - Intergenic
1129492339 15:75940495-75940517 AATTTCATGTGGAATCTGAAGGG + Exonic
1132208972 15:100006497-100006519 TATTTTATGTTGAATATAGAGGG + Intronic
1134684178 16:16147162-16147184 AAGTATCTGTGGATGATGGATGG + Intergenic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1136869380 16:33791416-33791438 AAACTTATGTGGAAGATTGTAGG + Intergenic
1137995997 16:53213452-53213474 AATTTTATGGGATGGATGGATGG + Intronic
1139173821 16:64662806-64662828 ACTTTTATGTGGATGAGGGAAGG - Intergenic
1139214646 16:65115276-65115298 TATTTTAAGTGGAAGAGGGATGG + Intronic
1139249915 16:65485423-65485445 CATCTCATGTGGAAGATCGAGGG + Intergenic
1139559070 16:67730250-67730272 AAGAATATGGGGAAGATGGAGGG + Intronic
1140305243 16:73796899-73796921 AATGTTATGTGGAAAAGTGAAGG + Intergenic
1203102793 16_KI270728v1_random:1324652-1324674 AAACTTATGTGGAAGATTGTAGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1147909743 17:43848466-43848488 CATTTTAGGAGGAAGAAGGAAGG - Intronic
1148712051 17:49689094-49689116 AATATTCTCTGGCAGATGGATGG - Intergenic
1149244161 17:54685588-54685610 AATTTATTGTGGAATATGTAAGG + Intergenic
1149407650 17:56370592-56370614 AATTTGGAGTGGAAGAAGGAGGG + Intronic
1149631020 17:58123407-58123429 AATTATATGTGGAGGATGAGAGG - Intergenic
1149975710 17:61263617-61263639 AACTTCATGTGGAAGATCGGAGG + Intronic
1150163275 17:62917158-62917180 AATTTTAGGTGGAAGAGGGGTGG + Intergenic
1153184388 18:2470716-2470738 AATTATTTGTGGAGGATGGCAGG - Intergenic
1153668892 18:7391783-7391805 AATTTTTTTTTTAAGATGGAAGG + Intergenic
1155895551 18:31321440-31321462 AATATTTTGTAGAAAATGGAAGG + Intronic
1156127351 18:33922015-33922037 AATCATATGGGGAAGATGGAAGG + Intronic
1156711760 18:39956419-39956441 AATACCATGTGAAAGATGGATGG + Intergenic
1156763589 18:40624228-40624250 AATTTTATGTGGTTAATGTAAGG + Intergenic
1158171109 18:54601563-54601585 AACTTTATGTGGAAATGGGAAGG + Intergenic
1158183848 18:54748943-54748965 GATTCTCTGTGAAAGATGGATGG + Intronic
1159152210 18:64535069-64535091 ATCTCTCTGTGGAAGATGGAGGG + Intergenic
1159893668 18:73976537-73976559 AATTTTATGTAGAAGTCGTATGG + Intergenic
1160536250 18:79595583-79595605 AATTTTTTGTGAAAGGTGAAAGG - Intergenic
1164469922 19:28521722-28521744 AGATTTCTGTGGAGGATGGAAGG + Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1168370894 19:55833338-55833360 AAATGTATGTGGAAAATAGAAGG + Intronic
925444164 2:3913428-3913450 GATTTTATCTGGAAGCCGGAAGG + Intergenic
925581104 2:5412043-5412065 AATTTTATTTGAAATATGAAAGG + Intergenic
926642550 2:15253014-15253036 GAGTTCATGTGGAAGAAGGAGGG + Intronic
926788522 2:16545337-16545359 AATTTTATAAGGCAGATGAAAGG + Intergenic
926995150 2:18727087-18727109 AATGTTATGTGACAGATGAATGG + Intergenic
927357653 2:22191661-22191683 ATATTTATGTAGAAGATGAATGG + Intergenic
928751573 2:34476510-34476532 AATTTTATATTGAAGACGGAGGG - Intergenic
930044144 2:47154491-47154513 AATTTAAAGTGGTAGATAGATGG - Intronic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
932959813 2:76399411-76399433 ATTTTTATTTGGAATTTGGATGG + Intergenic
934325596 2:92011482-92011504 AATTTCCTTTGGAAGCTGGATGG - Intergenic
934511280 2:94946517-94946539 AATTTTGGGGGGTAGATGGAGGG - Intergenic
934525824 2:95050903-95050925 AATTGTGTGAAGAAGATGGAGGG - Intronic
934981379 2:98845572-98845594 AATTTTAAGTGGAAGAGGGTTGG + Intronic
935019165 2:99213770-99213792 CATTTTATGTGGATGGTGGCAGG - Intronic
937544589 2:123001569-123001591 AACTTTGTGAGGAAGAAGGAAGG - Intergenic
937829222 2:126401681-126401703 ATTTTTTTGTGGAAGCTTGATGG + Intergenic
940189708 2:151027669-151027691 AAATTCATGTGGAAAATGCATGG + Intronic
940256336 2:151734397-151734419 AAATTTATTTGGTAGATTGAAGG - Exonic
940303972 2:152205954-152205976 AACTTTATGTGGAAGAGCAAAGG + Intergenic
940436495 2:153662343-153662365 AAGTTTATGTGGGAGAATGAAGG - Intergenic
940522720 2:154771225-154771247 AAATTTATCTGGAAGAGGAAGGG + Intronic
941252947 2:163189145-163189167 AATAATATGTGGAAGATGCTTGG + Intergenic
941286816 2:163624283-163624305 AATTTTAAGTAGAAGATCCATGG + Intronic
941922545 2:170865899-170865921 AAATTTATATGGAAGATTGAGGG - Intergenic
943129539 2:183839128-183839150 TATTTTAAATGGAAGCTGGAAGG - Intergenic
943768613 2:191690924-191690946 ATCTTTACGTGGAAGATGAAGGG - Intronic
944075446 2:195724808-195724830 AATTTTATATGGAAAGGGGAAGG + Intronic
944965241 2:204924717-204924739 AATTTAATGTAAAAGTTGGAAGG + Intronic
945276485 2:207992641-207992663 AATCTGGTGTGGGAGATGGATGG + Intronic
945752847 2:213809895-213809917 AGTTGTATGTGGTAGAAGGATGG + Intronic
946265073 2:218533480-218533502 AATTTGATGTGGAGGAGAGAAGG - Intronic
946978112 2:225175675-225175697 ATTTTTATTTGGTAAATGGAGGG - Intergenic
947332032 2:229039308-229039330 AATTCTGTGTGGAAAATAGAAGG + Intronic
948003750 2:234590476-234590498 ATTTTTATCTGGAAGGAGGAGGG + Intergenic
948057717 2:235021315-235021337 AAGTTTATTTGGAAGAGGGCCGG + Intronic
948232853 2:236364908-236364930 AAGTTTATGTGGAGAATGGTAGG - Intronic
948689603 2:239693740-239693762 AATATTAGGGAGAAGATGGAGGG - Intergenic
1169312095 20:4551835-4551857 AATTCTATGTCCAAGATAGAAGG - Intergenic
1170404105 20:16018549-16018571 ATTTTGGTGGGGAAGATGGAAGG - Intronic
1171781418 20:29422070-29422092 TGTTTTATGTAGAAGAAGGAGGG - Intergenic
1175432082 20:58912421-58912443 AATGTTACGTGAAAGTTGGATGG - Intergenic
1176595017 21:8685276-8685298 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1177986926 21:27987766-27987788 AATTCTATATGGATGATGGCAGG + Intergenic
1180277870 22:10662434-10662456 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1180585103 22:16881267-16881289 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1181076791 22:20383907-20383929 AGTTTTATGAAAAAGATGGAAGG - Intronic
1181150983 22:20883375-20883397 AATTTCATCTGGAAAATGGGTGG - Intronic
1182166915 22:28184340-28184362 AATATAATGAGGAAGAAGGAGGG - Intronic
1184933377 22:47698612-47698634 AAGTTTCTGTGAATGATGGATGG - Intergenic
949605471 3:5647992-5648014 AATGTTAATTGAAAGATGGATGG + Intergenic
949667538 3:6357713-6357735 AAGGTCATGTGGAAGATGGTGGG + Intergenic
951136939 3:19114766-19114788 AACTTTATGTGCAAGATCAATGG - Intergenic
951152509 3:19308498-19308520 AATATTATATGGAAGATTGTGGG - Intronic
951449534 3:22820737-22820759 AAATTTATGTGGAAGTAGAAAGG + Intergenic
953333794 3:42076801-42076823 TTTTTTATGTGGCAGAAGGAAGG + Intronic
954154862 3:48679782-48679804 AATGGTATGTGCAGGATGGAGGG - Exonic
954818007 3:53299286-53299308 CCTTTTCTGTGGATGATGGAAGG - Intronic
956260495 3:67335550-67335572 CATTTTGAGTGGAAAATGGAGGG + Intergenic
956327383 3:68069302-68069324 CATTTTATGTGGATGGTGGCAGG + Intronic
957769623 3:84674056-84674078 AATTTTGTGTGGATGAGGCATGG - Intergenic
957781209 3:84820230-84820252 CATTTTATGTGGATGGTGGCAGG + Intergenic
958077170 3:88695491-88695513 TATTTTTTGTGTAAGATGTAAGG - Intergenic
958120418 3:89280243-89280265 TATTTTGAGTGGAAGTTGGATGG + Intronic
958358357 3:92932304-92932326 AATTTTCTGTGGAATTTGCAAGG + Intergenic
958816013 3:98916298-98916320 AACTTCTTGTGGAAGATGGTAGG + Intergenic
958859228 3:99425299-99425321 AATTTTAAGTGGTATTTGGAAGG + Intergenic
959103057 3:102035517-102035539 AATTTTATTTGCTATATGGAGGG - Intergenic
959445754 3:106436793-106436815 AATTTTGTGTTGAACATGGTGGG + Intergenic
960742953 3:120855229-120855251 GATTCTATGTGGAGGAGGGATGG + Intergenic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962129438 3:132657419-132657441 AATTTTATGTGTAAGAGCGAAGG - Intronic
962912772 3:139869999-139870021 AATGTGATGTGACAGATGGAGGG + Intergenic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
964129490 3:153270966-153270988 ACTTTTTTATGGTAGATGGAAGG + Intergenic
964571719 3:158114163-158114185 AATTTTTTGTGTAAGATATAAGG + Intronic
964701278 3:159570311-159570333 AATTTTTTGTATAAGATGTAAGG + Intronic
964973532 3:162589980-162590002 AGTCTCATTTGGAAGATGGAGGG + Intergenic
964995954 3:162881604-162881626 AATTTTATGTGAGAGTTGGGTGG - Intergenic
967000767 3:185331865-185331887 AATGTTATGTGTAAAAAGGAGGG - Intronic
967011025 3:185434226-185434248 AAGTTTATGTGAACAATGGAAGG + Intronic
970107997 4:12606725-12606747 AGTTTTATGTGGGGGGTGGAAGG - Intergenic
970581799 4:17480304-17480326 AATTTTATATGGAAGTATGACGG - Intronic
970939918 4:21620018-21620040 AATGTTTTGTGGAAGAAGTAAGG + Intronic
971734560 4:30429901-30429923 GATCTTATGTGGAAGAAAGATGG - Intergenic
972316604 4:37932724-37932746 TATTTTATGTGGAAGTTGTTTGG - Intronic
972672926 4:41231189-41231211 AAAATTATTTGGAAGAAGGAAGG + Intergenic
973095825 4:46198066-46198088 AATTTTATGTTGAAGAGATAAGG - Intergenic
974343920 4:60653589-60653611 AAATTTCTGTGGAAGATATAAGG - Intergenic
974438835 4:61891277-61891299 TAGTATATGTGGAAGAAGGAGGG + Intronic
975058688 4:69969532-69969554 AATTTTATTCTGCAGATGGAGGG + Intergenic
976517935 4:85993093-85993115 AATTTAATTTGGAAGATATAAGG + Intronic
978202727 4:106042055-106042077 AATTTTATGTGGAAAACTAATGG - Exonic
978301926 4:107279495-107279517 AATTTGATGTGAAAGATTTAGGG + Intronic
978556656 4:109988425-109988447 AACTTTATGTCCAAGATGCAGGG + Intronic
978657630 4:111083573-111083595 AATTTTATGTGTCAGTTTGATGG - Intergenic
980295090 4:130903286-130903308 ATTTTGATGTTGAAGAAGGATGG - Intergenic
980561449 4:134481854-134481876 AATATTATGTTGAATAAGGATGG + Intergenic
981435356 4:144714623-144714645 AAATTTATGTTGAGGATGAAGGG - Intronic
982872030 4:160592325-160592347 AACAGTATGTGGAAGAGGGATGG + Intergenic
983108325 4:163718126-163718148 AATTTTTTGTGTAAGATGTAAGG - Intronic
983698771 4:170566058-170566080 AAATTTATATTGAAGATAGAGGG + Intergenic
984156122 4:176197938-176197960 AAATTTATTTGGATGATGAAGGG + Intergenic
987147758 5:15009048-15009070 GGTTTTCTGTGGAAGATGCACGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987683683 5:21169153-21169175 AATTTAACGTGAAAGATGTATGG + Intergenic
988233914 5:28514579-28514601 AATTTCATATGGTAGATGAAAGG - Intergenic
988669045 5:33361312-33361334 CATCTTATGTGGATGATGGCAGG + Intergenic
990492156 5:56313005-56313027 CATTTTGTGTAAAAGATGGAAGG + Intergenic
990818228 5:59808903-59808925 AATTTTAAGTGGAGGCTGAAAGG + Intronic
991140800 5:63240137-63240159 GATTTCATATGGAGGATGGAAGG - Intergenic
991308915 5:65213140-65213162 CATTTTATGTGTAAAATGGCTGG - Intronic
992387266 5:76296873-76296895 TATTTTATGTGGGAGAGTGAAGG - Intronic
993370125 5:87082982-87083004 AATTTTATGAAGAAGATAGAAGG - Intergenic
993522659 5:88922465-88922487 AATTTCAAGTGGAAAATGCATGG - Intergenic
994100884 5:95891427-95891449 AATTTTACCTGGAAGATGTTTGG - Intronic
995381231 5:111535805-111535827 AGTTATATGTGATAGATGGATGG - Intergenic
995890193 5:116942470-116942492 AATTCTCTGTGGGTGATGGATGG + Intergenic
996156752 5:120111946-120111968 AATTTCAGTTGGATGATGGAAGG + Intergenic
996247185 5:121279383-121279405 AATTTAAGGTGGCAGCTGGAAGG + Intergenic
996303322 5:122015914-122015936 AAGTATATGAGGAGGATGGAGGG - Intronic
996675058 5:126165508-126165530 TATTTGATGGGGAAGGTGGAGGG - Intergenic
996788045 5:127262277-127262299 TATTTTTTGTGTATGATGGAAGG + Intergenic
996883323 5:128326220-128326242 AGCTTTATGTGGAAGATAGCTGG + Intronic
997322741 5:132992235-132992257 TATTTTATTTGGAAGATGACAGG - Intergenic
999024895 5:148217588-148217610 ACTTTTGTGTGGAAGAAGGCTGG - Intergenic
999179551 5:149659480-149659502 AATTTTATCAGGAAAAGGGAGGG + Intergenic
999380164 5:151115842-151115864 TATTTGATGTGGAAGCTGCAGGG + Intronic
999958476 5:156727823-156727845 AAATTTGTATGAAAGATGGAAGG - Intronic
1000671840 5:164072835-164072857 AATTTTTTCTAGAAGATAGAAGG - Intergenic
1001868493 5:175128723-175128745 AAATTTATATGGAAGATCAAAGG + Intergenic
1002669136 5:180851012-180851034 AATTTTATGTTGAACAAGGCGGG + Exonic
1005104101 6:22204531-22204553 AATGGAATGTGGAAGATCGAGGG - Intergenic
1005442863 6:25889980-25890002 GATTCTATGTGGAAGATGGGTGG + Intergenic
1005912671 6:30325166-30325188 GATTTTATGCTGAATATGGAAGG - Intergenic
1006030644 6:31174458-31174480 AATTTTATGTCTGAGTTGGAAGG - Intronic
1006485611 6:34338538-34338560 AGTGTTTTGTGCAAGATGGATGG + Intronic
1006605767 6:35256746-35256768 ATTTTTAAGTGGATGATGGTAGG + Intergenic
1006715639 6:36118196-36118218 ATTTTAAAGTGGCAGATGGATGG - Intergenic
1007320241 6:41023245-41023267 ACTTTGATTTGGAATATGGAGGG - Intergenic
1008027521 6:46654562-46654584 AATTGTGTGTGGAGAATGGATGG + Intronic
1008423228 6:51327283-51327305 AATTTTTTGGGGACCATGGAAGG + Intergenic
1008767938 6:54942288-54942310 AAATTTTTGTGGACGATGTATGG + Intergenic
1009556466 6:65176593-65176615 GATTTTATGTGGATGAAGAATGG - Intronic
1009789529 6:68384489-68384511 AGTTTTATGAGGAGGATAGAAGG - Intergenic
1010223131 6:73464928-73464950 AAGTTTTTGTGGGAGGTGGAGGG - Intronic
1010550903 6:77221671-77221693 CATTTTATGTGGATGGTGGCAGG - Intergenic
1011029703 6:82908700-82908722 AATATTAGGAGAAAGATGGATGG + Intronic
1012835720 6:104264017-104264039 ATTTTTAAGTGGAAGATGGTGGG - Intergenic
1012918327 6:105195172-105195194 TATTTTGTCTTGAAGATGGAAGG + Intergenic
1013919617 6:115387812-115387834 TATTTGATGAGGAAGGTGGAGGG + Intergenic
1014380436 6:120734149-120734171 TTTTTTATGTGGTAGAGGGAGGG + Intergenic
1014474996 6:121861211-121861233 AATTTTTTGTATAAGATGTAAGG + Intergenic
1015064832 6:129011809-129011831 CATTTTAAGTGGAAAAGGGATGG + Intronic
1015280982 6:131433828-131433850 AGTTTTGAGTGGAAAATGGAGGG + Intergenic
1016124110 6:140378607-140378629 AATTTTATGAGAAAGTTGCATGG + Intergenic
1016225117 6:141725251-141725273 AATTTTATGTGTCAGCTTGATGG - Intergenic
1016537501 6:145125360-145125382 CATCTTATGTGGATGATGGCAGG - Intergenic
1017568529 6:155715145-155715167 AAATTGATGTGGGAGATGCATGG - Intergenic
1017666750 6:156726457-156726479 ATTTTTATGTGGTAGGTGTAAGG + Intergenic
1019868134 7:3732092-3732114 AATTTTATTTTTAAGATGGAAGG + Intronic
1020543891 7:9498706-9498728 TATTTTATGAGGAAGATAGCAGG + Intergenic
1020605494 7:10331976-10331998 AATCTTATTTGGGAAATGGAAGG - Intergenic
1020737939 7:11975248-11975270 ATTTTTATGTGGTATAAGGAAGG - Intergenic
1020816280 7:12909716-12909738 AATTGTAAGTGGAACATGGTGGG + Intergenic
1021083737 7:16394664-16394686 AATTGTATCTGAAATATGGATGG - Intronic
1021320904 7:19209943-19209965 ACATTTTTTTGGAAGATGGAGGG - Intergenic
1021534105 7:21683246-21683268 ATTTTTAACTGGAAGATGAATGG + Intronic
1021839443 7:24710511-24710533 AATTTTATGGGGAAGATGGATGG - Intronic
1022471424 7:30683823-30683845 AGGTTTATGTGGAGGATGGCAGG - Intronic
1023031911 7:36097066-36097088 CAATTTCTGTGGAAGATGCAGGG - Intergenic
1023658538 7:42450344-42450366 AATTAAATGTAGAAGAGGGAGGG + Intergenic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1024529731 7:50381825-50381847 ACTTTTCTTTGGAAGATGGGAGG + Intronic
1024832610 7:53479045-53479067 AATTTTCTGTGGAAGCAAGATGG - Intergenic
1026236686 7:68533520-68533542 AATCTTATTTGGAAGGAGGAAGG - Intergenic
1026478450 7:70758128-70758150 TATCTTTTGTGGAAAATGGAGGG - Intronic
1027854306 7:83489111-83489133 AATTATTTTGGGAAGATGGAGGG + Intronic
1029409885 7:100402309-100402331 AATCTGAGGTGAAAGATGGAAGG - Intronic
1029942145 7:104491484-104491506 AATTATAGGTGGAAGAGGGAGGG + Intronic
1030406265 7:109118221-109118243 AATTTTATGTGTGAGTAGGAAGG + Intergenic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1031463907 7:122084779-122084801 CTTTTTATCTGGAAGATGTAAGG - Intronic
1034480406 7:151315513-151315535 AAGTTTATGAGGGAGGTGGATGG - Intergenic
1034843796 7:154424537-154424559 ACTTAAATGTGGAAGAGGGAGGG - Intronic
1039408557 8:37333030-37333052 AATTTTATGGGAATTATGGAAGG - Intergenic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1041899789 8:62969017-62969039 CACTTTATGTGGTAGGTGGAAGG - Intronic
1042061254 8:64820524-64820546 AATTACATGTGGAAGGTTGAGGG - Intergenic
1042158730 8:65870464-65870486 AACTTTATGTTGAAGGTGCAAGG - Intergenic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043277547 8:78418770-78418792 AATTTTAAATAGAAGATAGAAGG - Intergenic
1043428019 8:80167786-80167808 AATTTTAAGGGGAAGAGGAATGG - Intronic
1044090405 8:87993203-87993225 CATGGTATGTGGAATATGGAAGG - Intergenic
1045810219 8:106212527-106212549 AAAATTATGTTAAAGATGGAGGG - Intergenic
1046029865 8:108770521-108770543 TAATTTATGTGGAAGCTAGATGG - Intronic
1046254943 8:111683799-111683821 AATATTATGTGGAATAAAGATGG + Intergenic
1046541135 8:115585437-115585459 AATTTTAAGTAGAAAAAGGAAGG + Intronic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1047918900 8:129612570-129612592 TATTTTATATTGGAGATGGAAGG - Intergenic
1048572895 8:135669730-135669752 AGTCTCATGTGGAAAATGGAAGG + Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1050721574 9:8597438-8597460 AATTCTTTGTGGAACAAGGAGGG - Intronic
1053694042 9:40618910-40618932 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1053941033 9:43249329-43249351 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054270793 9:63021217-63021239 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1054305287 9:63418134-63418156 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054404034 9:64742123-64742145 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054437655 9:65227623-65227645 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054492748 9:65794344-65794366 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1054890578 9:70246774-70246796 GATTTTATGTGGCAGTTAGAAGG + Intergenic
1055494179 9:76838209-76838231 AATATTTTATGGAAGAAGGAAGG + Intronic
1055902813 9:81260704-81260726 TATTTTATGTTTAAGATGGTGGG - Intergenic
1056039222 9:82644175-82644197 AAATTTTTGTGAAAGATGTAAGG + Intergenic
1056080754 9:83092239-83092261 ATTTTTATCTGGAATTTGGAGGG - Intergenic
1058364839 9:104196697-104196719 GATTATTTGTGGAAGATAGATGG - Intergenic
1059005558 9:110398316-110398338 AATTTTTTGTGTAAGGTGTAAGG - Intronic
1059019614 9:110560986-110561008 GATTTTATTTTGTAGATGGAGGG - Intronic
1060634260 9:125187925-125187947 AATTTTATGTGGCATATGATAGG - Intronic
1185923382 X:4119236-4119258 AACTTTATGTAAAAAATGGAGGG - Intergenic
1186429740 X:9494956-9494978 TGTTTTATGTGGGAAATGGATGG - Intronic
1187573961 X:20534234-20534256 AATTGCATGTGGGAAATGGAAGG + Intergenic
1187611435 X:20947933-20947955 TAGTTTATGTGGTAGATGGATGG + Intergenic
1187629995 X:21158671-21158693 AATTGTAAGTGGAAAATGGATGG + Intergenic
1188339369 X:28979871-28979893 AATTTCATGTGGTAGATTAAGGG - Intronic
1188417455 X:29953605-29953627 TATTTTATGTGTAAGATGAGTGG + Intronic
1188873548 X:35402537-35402559 GGGTTTATGTGGAAGTTGGAAGG - Intergenic
1189016808 X:37293459-37293481 GATTTTATGGATAAGATGGATGG + Intergenic
1189164798 X:38850184-38850206 AAATTAATGTGGAAAAGGGATGG - Intergenic
1190386996 X:49892108-49892130 AATTTTTGGTTAAAGATGGAGGG + Intergenic
1192083531 X:68071379-68071401 ACTTTCATGTGGAAGAAGAAGGG - Intronic
1192152638 X:68721697-68721719 ACATTGAGGTGGAAGATGGAGGG - Exonic
1192390465 X:70721381-70721403 AATTCTTTTTGGAAGAAGGAAGG + Intronic
1192674278 X:73178722-73178744 TAATTTTTGTGGAAGATGTAAGG - Intergenic
1192730469 X:73798117-73798139 AGATTTATTAGGAAGATGGAAGG + Intergenic
1195915582 X:109932050-109932072 GATTGAATGTGGAATATGGAGGG + Intergenic
1195990311 X:110675999-110676021 AATTATATGTGGGAGGAGGAGGG - Exonic
1196678627 X:118447231-118447253 AATTTCCTGTGGAATATGCAGGG - Intronic
1198633350 X:138667834-138667856 GATTCTATGTGGGAAATGGATGG + Intronic
1198945919 X:142013710-142013732 AAATATATATTGAAGATGGATGG + Intergenic
1201191813 Y:11450463-11450485 AATTTCCTTTGGAAGCTGGATGG - Intergenic