ID: 921431130

View in Genome Browser
Species Human (GRCh38)
Location 1:215067427-215067449
Sequence CTCATTGTCAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921431130 Original CRISPR CTCATTGTCAAGAGGGAAGA GGG Intronic
901357298 1:8662259-8662281 TTCATTTTGAAGAGGTAAGATGG - Intronic
901910179 1:12450893-12450915 TTCCTTGTCACCAGGGAAGATGG - Intronic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902669646 1:17964229-17964251 CTCACTGTCAGGAGTGGAGAAGG - Intergenic
904090472 1:27941534-27941556 GACATTGTAAACAGGGAAGATGG + Intronic
904365067 1:30005509-30005531 TTCCTTATCAAGAGGGGAGAGGG + Intergenic
904893055 1:33793683-33793705 CTCATTGGCAGGAGTGAGGATGG + Intronic
905200369 1:36311618-36311640 CTCATTGTCCATAGGGAAAAAGG - Intronic
905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG + Intergenic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
905339742 1:37270344-37270366 CTCAGTTTCATGAAGGAAGAAGG + Intergenic
905414776 1:37796235-37796257 CTCACTTTCAAGAGGAAGGACGG + Intronic
906855401 1:49298644-49298666 CTTATTTTCAAGAAGGAGGAGGG - Intronic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
908526987 1:64997777-64997799 AGCATTGTCAAGAATGAAGAGGG - Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909627694 1:77736513-77736535 CTCATTTTCAACAGGGAAAAAGG + Intronic
910525628 1:88174622-88174644 CTGATTGACACCAGGGAAGATGG + Intergenic
911688803 1:100808036-100808058 CTCATTGATAAGAGGGAACCTGG + Intergenic
911754326 1:101535452-101535474 CTGATTGTCAAGAGGAAATAAGG - Intergenic
912128915 1:106576852-106576874 CTCCTTGTCAGTAGGGAAAATGG + Intergenic
912163259 1:107012050-107012072 TTCATTGTCAAGTAGAAAGATGG + Intergenic
912429673 1:109622435-109622457 CTCCTGGTCGAGAGGGGAGATGG + Intronic
912500370 1:110117897-110117919 CTCATTTTCAAAATAGAAGAAGG + Intergenic
912570521 1:110617892-110617914 TTCCTTGTCAACAGGGCAGATGG + Intronic
914934787 1:151968827-151968849 CAACTTCTCAAGAGGGAAGAGGG + Intergenic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
918368536 1:183835663-183835685 GTCAGTGTCAAGAGGTAAGAAGG + Intronic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
919243016 1:194939076-194939098 GCCATAGTCAACAGGGAAGAGGG + Intergenic
920189770 1:204186166-204186188 TTCATGGTTAAGAGGGAAGCAGG + Intergenic
920421615 1:205838044-205838066 CTCATTGTAGAGCGGGGAGAAGG - Intronic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
922300886 1:224299433-224299455 CTCATTCTCATTAGCGAAGAGGG + Intronic
922909900 1:229206575-229206597 CTCAGGGTCCAGAGAGAAGAGGG - Intergenic
924277599 1:242404109-242404131 CTCACTGTCTAGAGAGGAGAGGG + Intronic
924646717 1:245884619-245884641 GTGATTGACAAAAGGGAAGATGG + Intronic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1063811849 10:9720240-9720262 ATTATTGTGAAGATGGAAGAAGG + Intergenic
1065178808 10:23104731-23104753 TACCGTGTCAAGAGGGAAGATGG - Intronic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072328897 10:94326218-94326240 CTCATTGTCATAAAGGCAGATGG - Intronic
1074743237 10:116505370-116505392 CACATTGTTAAGAAGGAAGCAGG - Intergenic
1075619419 10:123914883-123914905 CAAATTGTCAGGAGGCAAGAGGG - Intronic
1076021082 10:127074049-127074071 AGCATTATCAAGAGGGAAAAAGG + Intronic
1076218075 10:128711596-128711618 CTCATTCTCAGGAGGGGAGAGGG - Intergenic
1079354639 11:19720025-19720047 CTCATTGTTCTGAGGGCAGAAGG + Intronic
1079449186 11:20584649-20584671 GTCATTGTTAAGAGATAAGAGGG + Intergenic
1081677466 11:44979302-44979324 CTTATTGTTGAGAGGGCAGAGGG + Intergenic
1082007219 11:47426132-47426154 GCCATTGACAAGAGGGAAGGAGG - Intronic
1083420364 11:62549060-62549082 CTCTTGGTCAACAGGGAAGAAGG + Intronic
1083488091 11:62996048-62996070 TTCAATGGCAAGAAGGAAGAGGG - Exonic
1083738570 11:64695420-64695442 CACAGTGTCAAGTGGGAAGAAGG + Intronic
1085942498 11:81221785-81221807 CTTATTGCCAAGAAGGATGAAGG + Intergenic
1086382680 11:86274167-86274189 CTCAATATCAAAAGAGAAGAGGG - Intronic
1088416168 11:109591225-109591247 CTGACTGTCAAGGGGAAAGATGG + Intergenic
1088816159 11:113422473-113422495 CTCCTTTGGAAGAGGGAAGAAGG + Intronic
1089234309 11:117010144-117010166 CCCATTGTGAATAAGGAAGAGGG - Intronic
1090208324 11:124897850-124897872 CTCACAGTGAAGAGGGAAGGAGG + Exonic
1090914946 11:131155022-131155044 TTCACTGTGAAGAGGGAAGTGGG + Intergenic
1091249743 11:134133063-134133085 CTTGTTGTCAAGATGGATGAGGG + Intronic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1092232024 12:6781225-6781247 CTCCTTGTTAAGAAGGAAGGGGG + Intergenic
1092963784 12:13622004-13622026 GTCATTGTGAAGAAGGGAGAGGG + Intronic
1093247044 12:16752013-16752035 GATACTGTCAAGAGGGAAGAGGG + Intergenic
1093843519 12:23937034-23937056 CTGTTTGTCAAGAGCTAAGAAGG + Intronic
1094502705 12:31035422-31035444 CTCATTGCTAAGGAGGAAGAGGG - Intergenic
1094719243 12:33046057-33046079 TTCATTGTAAATAGGGAGGAAGG + Intergenic
1096896522 12:54826243-54826265 CTCACAGTGAAGAGGGAAGAGGG - Intergenic
1100364962 12:93911643-93911665 TTCAGTATCAAGAGGGATGATGG - Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102607251 12:114077455-114077477 ATCCTGGTCAAGTGGGAAGAAGG - Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103519192 12:121526397-121526419 CACATAGTCAAGAGTCAAGAAGG + Intronic
1104186864 12:126440957-126440979 CTCATTTTCAAGTAGAAAGATGG - Intergenic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1108268106 13:48732436-48732458 CTCAATGACAAGAGTGGAGAGGG - Intergenic
1109996160 13:70129863-70129885 CTCAGAGTCAAGCGGGAACAAGG + Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1110611177 13:77489969-77489991 CTCATAGTCTCGAGAGAAGATGG - Intergenic
1111186158 13:84738533-84738555 CTCAATGTCAAGAGGCAAGGTGG + Intergenic
1111193507 13:84840482-84840504 CTTATGGTCAAGAGTGAAGTTGG + Intergenic
1112210117 13:97368001-97368023 CTCATTCTTAATAGGGAAGCTGG + Intronic
1113112593 13:106839891-106839913 CTCAATATCAATAGGGAACAGGG - Intergenic
1114004746 14:18300410-18300432 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1116863627 14:50014142-50014164 CTGATTGTCAAGATGTAAAAGGG + Intergenic
1118531374 14:66709880-66709902 ATCAGTGTCAAGAGAGAAGTTGG + Intronic
1118913856 14:70084613-70084635 CTCAATGTCTAGAGGGAATGTGG + Intronic
1119635478 14:76269852-76269874 CGCATTGTGGAGAGGGAGGAAGG - Intergenic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1121202004 14:92125561-92125583 CTCATTATCAAGTAGAAAGATGG - Intronic
1121993508 14:98583818-98583840 CTCATTTTCAAAAGGGAGCATGG - Intergenic
1124602938 15:31149834-31149856 CAGAATGTCAAGATGGAAGAGGG - Intronic
1126204440 15:46028152-46028174 CTCAGTTTCAAGTGGGGAGAAGG - Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127849747 15:62902186-62902208 CTCACAGACAATAGGGAAGAAGG + Intergenic
1127999891 15:64181128-64181150 CTCTCCGACAAGAGGGAAGATGG + Intronic
1128438103 15:67675867-67675889 CTCATTTTCAGAATGGAAGAGGG - Intronic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1130440223 15:83945612-83945634 CCCATTGTCAGGAGAGATGAAGG + Intronic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1131090128 15:89617986-89618008 ATTATTGTCAAGAGGGAGGCTGG - Intronic
1131602777 15:93866409-93866431 CTCAGAGGCATGAGGGAAGAAGG + Intergenic
1131730757 15:95277993-95278015 TTCATTGTCAAGAGGCATTATGG + Intergenic
1132115551 15:99133006-99133028 CTCATTGTCTAGATAGAGGAGGG - Exonic
1139809183 16:69598472-69598494 ACCATTGTTAATAGGGAAGACGG + Intronic
1140281142 16:73556371-73556393 ACCATTGTCAGAAGGGAAGAAGG - Intergenic
1141061870 16:80880887-80880909 CTCATTCACAATAGGGAAGGAGG + Intergenic
1141186113 16:81788807-81788829 CAAACAGTCAAGAGGGAAGATGG - Intronic
1141441437 16:84032050-84032072 CTCATTGTCAAGGGCGGAGCTGG - Intronic
1141872007 16:86793534-86793556 CACATTTGCAAGAGGGAAGCAGG - Intergenic
1141877713 16:86837571-86837593 TTCATTGACAAGAGCAAAGAGGG - Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1146466423 17:33090196-33090218 TTCAGTGACAAGTGGGAAGATGG - Intronic
1147010074 17:37438826-37438848 TTCTTTGTTAAGAGGGAAGGAGG - Intronic
1147451571 17:40508559-40508581 CTGATTGACATGAGAGAAGATGG - Intergenic
1147895236 17:43746277-43746299 CTCATAGTCCAGAGGGGAGACGG + Intergenic
1148741988 17:49898232-49898254 CTCATTTTCAAGAGAGGAGATGG + Intergenic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149557272 17:57582717-57582739 CTGATTGACATCAGGGAAGATGG - Intronic
1150635626 17:66911346-66911368 CTCAGTGACAGGAGGGATGATGG - Intergenic
1151643782 17:75415749-75415771 CTCATAGTCTAAAGGGGAGAGGG - Intergenic
1153534463 18:6086143-6086165 CTCATTGTAAAGAGTAAAGTGGG - Intronic
1153584481 18:6607326-6607348 CTCATTGTCTACAGGAAAGTTGG - Intergenic
1156852618 18:41745894-41745916 CTCCATGCCAAGGGGGAAGAAGG + Intergenic
1156907657 18:42373497-42373519 CTTATAATCATGAGGGAAGAAGG + Intergenic
1162787088 19:13042269-13042291 CTCATTTTCAAAAGGGAATAGGG - Intronic
1165450340 19:35878745-35878767 TTCCTTGTCCTGAGGGAAGAGGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928029899 2:27769237-27769259 CTCCATGTCAAGAGAGGAGAGGG - Intergenic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928665588 2:33547917-33547939 CTCATTGGCAGGAGGTAACACGG - Intronic
929683102 2:44011244-44011266 TTCACTGTAAAGAGGGAAAAAGG - Intergenic
930438600 2:51377996-51378018 CTCACTGTCACGAGGACAGATGG - Intergenic
931468364 2:62512811-62512833 CTCACTGTTAAGGGAGAAGATGG + Intergenic
933212148 2:79582722-79582744 GGCATTGAAAAGAGGGAAGAAGG - Intronic
933521333 2:83378445-83378467 GTCATTGTTAAGAGCCAAGAAGG - Intergenic
934058136 2:88269750-88269772 CTCATTGTCTCGAGGGATGGAGG - Intergenic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
938620515 2:133047727-133047749 CTTGTTTTCAAGAGGGAACAGGG + Intronic
938698928 2:133859190-133859212 CTCATTCCCTAGAGGGCAGAAGG - Intergenic
940324270 2:152409010-152409032 TTCCTGGTTAAGAGGGAAGAAGG + Intronic
940487924 2:154320258-154320280 TTCATTGTCAAGGGAGAATAAGG + Intronic
941686908 2:168456605-168456627 CTCATCTTCGAGAGGTAAGAAGG + Exonic
943010729 2:182445390-182445412 GTCAATGTCAAGTGGGAAAATGG - Intronic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
943490212 2:188543972-188543994 CTCACTGTCACCATGGAAGAAGG - Intronic
946041949 2:216790352-216790374 CTCAGGGTCAACAGGGAACAGGG + Intergenic
946638561 2:221757630-221757652 GTCATTCAAAAGAGGGAAGACGG + Intergenic
948197947 2:236108964-236108986 CACATTGTCAAGGGGTAATAAGG - Intronic
948396073 2:237646166-237646188 ATTATTGTCATTAGGGAAGATGG + Intronic
1169965197 20:11209891-11209913 CTCATTTTCATGAGCCAAGATGG + Intergenic
1170806012 20:19632497-19632519 GTCCTTTACAAGAGGGAAGAAGG - Intronic
1171355081 20:24537717-24537739 GTCATTGGCAAGATGAAAGAGGG + Intronic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1172697284 20:36831484-36831506 CTCCTTGCCAGAAGGGAAGAGGG + Intronic
1173256388 20:41396675-41396697 CTCAGTGTGAAGAGGGGAGGGGG + Intergenic
1173407762 20:42781361-42781383 CACATCTTCAAGAGGCAAGAGGG + Intronic
1174936912 20:54881051-54881073 CTCATTGTCAAGAAACAAGATGG - Intergenic
1175283682 20:57821986-57822008 TTCATTGTGTAGTGGGAAGATGG - Intergenic
1175692515 20:61075806-61075828 CACATGGTGAAGGGGGAAGAAGG + Intergenic
1177406583 21:20675885-20675907 CTTATTGTAAAGAGGAAATAGGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1179060087 21:37971850-37971872 CTCCATGTCAAGAGAGAAGGAGG + Intronic
1179207888 21:39300726-39300748 CCCATGGTCAAGAGGGGAAATGG + Intronic
1180429260 22:15231200-15231222 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1184869118 22:47222357-47222379 CCCATTGTCCAGTGAGAAGAGGG + Intergenic
1184925751 22:47635924-47635946 ATTATTGTCAAGAGGGAGGGAGG + Intergenic
1185186858 22:49406437-49406459 CACAGTGTGAACAGGGAAGAGGG + Intergenic
952112566 3:30140954-30140976 TTGATTCACAAGAGGGAAGAAGG - Intergenic
954847547 3:53572955-53572977 GCCATGGGCAAGAGGGAAGATGG - Intronic
956110611 3:65866853-65866875 CTCGGTGTAAACAGGGAAGAAGG + Intronic
956767611 3:72497107-72497129 CTCAGTGTCAAGAAGGAAAAAGG - Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959582978 3:108000938-108000960 TTCTGTGTCAAGGGGGAAGAAGG - Intergenic
960299742 3:115987331-115987353 GTCACTGTGAAGGGGGAAGAGGG - Intronic
961632539 3:128311922-128311944 CACAGAGTCAAGCGGGAAGAGGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
969161482 4:5263080-5263102 CTCATAGTCTAGTGGAAAGAGGG - Intronic
969842928 4:9896434-9896456 CTCATTTTCAAGTGGGCAGTTGG + Intronic
970308207 4:14754611-14754633 CTTATTGCCAAGATGGAATATGG - Intergenic
970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG + Intergenic
970456541 4:16228129-16228151 TTGATTGTCAAGAAGGAAGTAGG + Intergenic
972016767 4:34256496-34256518 CACATTATAAAGAGGGAAGATGG + Intergenic
972575658 4:40348995-40349017 CTGGTTGTCAAAAGGGAAGTAGG - Exonic
972839079 4:42909897-42909919 GGCATTTTCAAGAGGGAAGGAGG + Intronic
976512753 4:85930144-85930166 CTCATTGAGAAAAGGGGAGACGG + Intronic
984877523 4:184382657-184382679 GTCATTGTCTAGAGAGAAGCAGG - Intergenic
985553698 5:545916-545938 CTCTTTGTGGAGGGGGAAGAGGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
987188209 5:15446279-15446301 CTCACTGACAACAGGGAATAAGG + Intergenic
989230332 5:39078478-39078500 CTGATTGACATTAGGGAAGATGG - Intergenic
991014544 5:61916879-61916901 CTCCTTCTCAAGAGGACAGATGG - Intergenic
994154982 5:96493400-96493422 CTCTCTGTGAAGAGGCAAGATGG - Intergenic
996003528 5:118392452-118392474 GACTTTGTGAAGAGGGAAGATGG - Intergenic
996386571 5:122915279-122915301 CTCAGGGTGAATAGGGAAGATGG - Intronic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
996640952 5:125752972-125752994 ATTATTGTCAAGAGAAAAGAGGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997187810 5:131900166-131900188 GTCAATAACAAGAGGGAAGAGGG + Intronic
1000110250 5:158101358-158101380 CTCATGGTCTAGAGGAAAGTAGG + Intergenic
1000857430 5:166416706-166416728 TTCATTATCAAGAGAGAAAATGG - Intergenic
1001203371 5:169739367-169739389 CTCATTCTCATGTGGGAATAAGG - Intronic
1001239183 5:170055393-170055415 CTCGTTGTCCACAGGGAAGAAGG + Intronic
1002858509 6:1058925-1058947 TTCAGTGTCAAAAGGGAAGGAGG + Intergenic
1003696845 6:8415575-8415597 CACATAGTCAAGTGGGAAGATGG - Intronic
1004605671 6:17192979-17193001 CACATGGTGAAGAGGTAAGAGGG + Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006052605 6:31355992-31356014 TTAATTGTCTAGAGAGAAGAGGG + Intronic
1006819029 6:36875869-36875891 CTAATTGTCAACAAGGAATAAGG + Intronic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007236999 6:40397718-40397740 CTAGTTGTAAAGAGGCAAGAGGG + Intronic
1007722701 6:43894787-43894809 CTCACTCACAGGAGGGAAGAAGG - Intergenic
1007988950 6:46234908-46234930 CCCATTCTCAGGAGGGAGGAGGG + Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008094178 6:47321809-47321831 TGCATACTCAAGAGGGAAGATGG - Intergenic
1010309477 6:74367435-74367457 TTCACTTTTAAGAGGGAAGAGGG - Intergenic
1010871195 6:81042872-81042894 TTAATTGTCAAAAGGGGAGAGGG - Intergenic
1012244820 6:96914556-96914578 TTCATTGTCATGAGGGAGAAGGG + Intergenic
1015066672 6:129038383-129038405 CTCATGATCAAGAAGGAAGATGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016937935 6:149462054-149462076 CTCATAATCAAGAGGGAACCAGG + Intronic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1019332415 7:466889-466911 CTCAATGGAAAGAGGGATGATGG - Intergenic
1021249360 7:18305222-18305244 CTTATCATCAAGAGTGAAGATGG - Intronic
1022546943 7:31198661-31198683 CTCATTGTCAAGGCAGCAGAAGG - Intergenic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025988047 7:66473308-66473330 TTGATTGTCAAGAAGGAAGTAGG - Intergenic
1027211035 7:76149203-76149225 TTGATTGTCAAGAAGGAAGTAGG - Intergenic
1027349127 7:77292654-77292676 CCCATTTTTAAGAGGTAAGAAGG - Intronic
1028130646 7:87168894-87168916 TTCTTTGTGAAGAGGGAATAGGG - Intronic
1028381209 7:90202030-90202052 CTCATTTTAAAGAAAGAAGAAGG + Intronic
1034098701 7:148433263-148433285 GTCATTATCTAGAGGGGAGAAGG + Intergenic
1035925404 8:3722540-3722562 GACATTGACAAGAGGTAAGAAGG - Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037656259 8:20886849-20886871 ATCATTGTCAAGATGGCAGGAGG - Intergenic
1039718352 8:40134995-40135017 CTCTTCGTCCAGAGGGAAGTAGG - Intergenic
1041340700 8:56842896-56842918 CTCACTGTCAGCCGGGAAGAAGG - Intergenic
1041923953 8:63216136-63216158 CTCATTTTCAACAGGGCAGTCGG + Intergenic
1041979146 8:63835780-63835802 CTCATTGTGGCCAGGGAAGATGG + Intergenic
1044771614 8:95641577-95641599 TTCAGTGTCAAGAAGGAAGATGG - Intergenic
1045630203 8:104110008-104110030 CTTATTTTCTAGAGGGGAGATGG + Intronic
1045639988 8:104238969-104238991 CTCAATGTCAATATGGAAAATGG - Intronic
1047734344 8:127752409-127752431 CTCATGGTCAAGGGGAAAGTAGG + Intergenic
1048122420 8:131596790-131596812 CACACTGTCAAGGGGGAATAGGG - Intergenic
1048867120 8:138769418-138769440 CTCCTTGGGAAGGGGGAAGATGG + Intronic
1048886406 8:138913537-138913559 CTCACTGTCATCTGGGAAGATGG + Intronic
1048941599 8:139404996-139405018 CTACCTGTCAAGAGGGCAGAAGG + Intergenic
1049208278 8:141373425-141373447 CTCATTGCTATGAGGGAAGGTGG - Intergenic
1050378386 9:4997382-4997404 CTCATGGTCAAAAGCTAAGAGGG + Intronic
1050809398 9:9725008-9725030 CACATTATCAAGAGGGAAACAGG + Intronic
1051206911 9:14697620-14697642 CTCCTAGGCAAGAGGGAGGAAGG - Intergenic
1052765248 9:32634104-32634126 CTCATTGTCAATGGGAAAAATGG + Exonic
1054877060 9:70107911-70107933 CTCAGTGTGAGGAGTGAAGAGGG + Intronic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1055074501 9:72199816-72199838 GTTATTGTCAGGAGGGTAGAGGG - Intronic
1056013718 9:82359678-82359700 CTCATTATCAAGTGGAAATAAGG + Intergenic
1058747094 9:108002374-108002396 CTCTCTGTAAAGAGGGAAAATGG - Intergenic
1186186930 X:7029793-7029815 CTCATTGGCTGGAGGGATGATGG + Intergenic
1186303139 X:8222522-8222544 CTGATTGTCAAGATGAAAGAGGG - Intergenic
1186387430 X:9124349-9124371 CTCTTTATCAAGAGAGAAAAAGG + Intronic
1186502842 X:10065902-10065924 CTCAGTGTTAAGGGGGAAGAAGG + Intronic
1189305319 X:39982495-39982517 CTCAATCTCAAGAAGGAACATGG + Intergenic
1190179689 X:48181782-48181804 CCCATTGCCAAAAGGGAAAAAGG + Intergenic
1190534510 X:51412263-51412285 CTCATAGTCTAGTGGGAAGATGG - Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192469145 X:71381782-71381804 CTCATTGTCAATGGGAAAAATGG - Exonic
1195348824 X:103977839-103977861 CCCTTGGTCAAGAGGGAAAAGGG + Intergenic
1195358619 X:104061000-104061022 CCCTTGGTCAAGAGGGAAAAGGG - Intergenic
1195626648 X:107010437-107010459 CGCAGTGTTCAGAGGGAAGAAGG + Intergenic
1196016767 X:110947859-110947881 CTCATTTTAAAGAGGGGGGAAGG - Intronic
1196910568 X:120480708-120480730 TTCATTGTACAGAGGGCAGAAGG - Intergenic
1197707831 X:129646942-129646964 GACATCATCAAGAGGGAAGAGGG + Exonic
1198681006 X:139182232-139182254 CTCATAGTAAAGAGAGAATATGG - Intronic
1199602928 X:149553625-149553647 CTCTTAGTCCAGAGGGGAGATGG - Intergenic
1199647461 X:149925850-149925872 CTCTTAGTCCAGAGGGGAGATGG + Intergenic
1202257275 Y:22934767-22934789 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202410266 Y:24568514-24568536 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202460516 Y:25101558-25101580 GTCTTTGTAAAGAAGGAAGAAGG - Intergenic