ID: 921431365

View in Genome Browser
Species Human (GRCh38)
Location 1:215069816-215069838
Sequence GGGATAATGAAGGTCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921431365 Original CRISPR GGGATAATGAAGGTCATGGA GGG Intronic
901607067 1:10467482-10467504 GGGAAAATCAAGGTCCTGGATGG - Intronic
902028852 1:13406253-13406275 AGGATAATGAAGTTAATGGTAGG - Intergenic
904872175 1:33625667-33625689 GGGAGACTGGGGGTCATGGAGGG - Intronic
904933925 1:34113042-34113064 GAGAAAAAGAAGGACATGGATGG + Intronic
904953838 1:34266642-34266664 GTGCTAATGGAGGTAATGGAAGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905111168 1:35595599-35595621 GGGCTAAAGAAGGACAGGGAGGG - Intergenic
906059704 1:42940469-42940491 GGGATAATGTAAGCCATCGAAGG - Intronic
907599201 1:55749831-55749853 GGGATGTTGAAGGTGATGAAGGG + Intergenic
908097168 1:60751042-60751064 GGGTTAGTGAGGGTCATGGATGG - Intergenic
908329038 1:63052283-63052305 AGGAAAATGATGGCCATGGAGGG + Intergenic
908643756 1:66254488-66254510 GGGATAGTTAAGGCCATGGCAGG - Intronic
908653787 1:66365713-66365735 AGGATGATCAACGTCATGGATGG - Exonic
909070431 1:70986702-70986724 GTGATAATGCAGGTAATTGAAGG - Intronic
909710482 1:78644111-78644133 GGGAGACTGAAGGTGATTGAAGG + Exonic
921138955 1:212286660-212286682 GGGAAAGTGAAGGTCGGGGAAGG - Intronic
921220418 1:212969746-212969768 GGGATAGTGAAGGATATGAATGG + Intronic
921337526 1:214103219-214103241 GGGATAAAGAAGGACAGGAAGGG + Intergenic
921431365 1:215069816-215069838 GGGATAATGAAGGTCATGGAGGG + Intronic
922204507 1:223434920-223434942 GGGATAAAGAAAGACATGCATGG + Intergenic
1063935730 10:11076140-11076162 GGGATATTGATGGTCATACATGG + Intronic
1065581617 10:27177500-27177522 GGCATCAAGAAGGTCATGGCTGG - Intronic
1068337037 10:55647400-55647422 AGGATATTGAAGGTCAGGCATGG + Intergenic
1069773656 10:70914669-70914691 GGGAGAGTGATGGTCATTGAAGG + Intergenic
1070092541 10:73302274-73302296 GAGATAAAGAAGGCCAGGGAGGG + Intronic
1071344240 10:84676464-84676486 AGGAGAGTGAAGGTCAGGGAGGG + Intergenic
1072794390 10:98343335-98343357 GGGCTAATGAAAGTCATCCAGGG + Intergenic
1073595971 10:104800542-104800564 GGGATACTGAAAGTGAGGGAGGG + Intronic
1075979179 10:126722398-126722420 GGGAGCCTGAAGGTGATGGAGGG - Intergenic
1076933285 10:133549011-133549033 GGGATGTTGAATGTTATGGAAGG - Intronic
1078544046 11:12234076-12234098 GGGGGAATAAAGGACATGGACGG - Intronic
1081965117 11:47164732-47164754 GGGATAAAGAATGTCACAGAGGG + Exonic
1083706186 11:64518027-64518049 GAGATAATGAATGTCAGGTATGG - Intergenic
1085841096 11:80012734-80012756 GGGATAGGAAAGGTCAGGGAAGG - Intergenic
1086599136 11:88610929-88610951 GGGATATTGAATTTTATGGAAGG + Intronic
1087334773 11:96829875-96829897 AGGGTAATGGAGGTTATGGATGG + Intergenic
1089069507 11:115688637-115688659 GAGATACTGAAGGTCAGGGAGGG - Intergenic
1089604894 11:119636087-119636109 GGGAGAAGGAAGATGATGGAAGG - Intronic
1090982037 11:131731550-131731572 TGGACAATAAAGGTCATGGCCGG + Intronic
1093654536 12:21679605-21679627 GGGAGAATGAGTGTAATGGATGG + Intronic
1095523233 12:43093719-43093741 GGGATACTTTAGGTCAGGGAAGG + Intergenic
1096046451 12:48566868-48566890 GGGAAAAGGAAGAGCATGGACGG - Intergenic
1096595247 12:52691083-52691105 GGGATCAGGAAGGGCGTGGAGGG + Exonic
1097400544 12:59123622-59123644 TAGATAAAGAAGGTAATGGATGG + Intergenic
1097710764 12:62914540-62914562 GGGAGAGGGAAGGTGATGGAGGG + Intronic
1097908620 12:64946127-64946149 TGGATAATGAAGGGAAAGGAAGG - Intergenic
1099115993 12:78624767-78624789 GGGAAAAAGCAGGTCAGGGAGGG - Intergenic
1102394455 12:112574854-112574876 GGGATAATGAAGGTGGAGGAAGG + Intronic
1103000873 12:117384552-117384574 GAGATAATGCATGTCATGTAGGG - Intronic
1105334468 13:19453323-19453345 GAGAGAATGAAGGACAGGGATGG - Intronic
1109791657 13:67256419-67256441 CGATTAATGCAGGTCATGGAGGG + Intergenic
1110763284 13:79253686-79253708 AGGGTAATGAAGGCTATGGAGGG - Intergenic
1111582196 13:90236744-90236766 GGGATGATGAAGATGATGGCTGG + Intergenic
1112471933 13:99697197-99697219 GGTATAATCAAAGTCTTGGAAGG + Intronic
1117959760 14:61151505-61151527 GGAAAATGGAAGGTCATGGAGGG + Intergenic
1121912930 14:97808630-97808652 AGGAAACTGAAGGTCATGGAAGG + Intergenic
1132906587 16:2285653-2285675 GGGACAGAGAAGGTCAGGGACGG + Intronic
1133118487 16:3591862-3591884 AGGATAAAAAAGGTCATGCATGG + Intronic
1133885732 16:9825946-9825968 GCGATGATGAAGATGATGGAAGG + Intronic
1134230046 16:12421911-12421933 CGGATGATGATGGTGATGGACGG - Intronic
1134564898 16:15242978-15243000 AGGGTAATGAAGGTCAGAGATGG - Intergenic
1134737598 16:16513720-16513742 AGGGTAATGAAGGTCAGAGATGG + Intergenic
1134929908 16:18198440-18198462 AGGGTAATGAAGGTCAGAGATGG - Intergenic
1135248711 16:20881567-20881589 GGCACAATAAAGGTGATGGAGGG - Intronic
1136242422 16:28952193-28952215 GGGATGAGGAAGGTAAGGGAGGG + Exonic
1137348248 16:47685012-47685034 AAAATAATGAAGGTTATGGATGG - Intronic
1141193696 16:81843239-81843261 GGGCAAATGATGGTCAAGGAGGG - Intronic
1141848028 16:86624199-86624221 GGATACATGAAGGTCATGGAAGG + Intergenic
1143963324 17:10738506-10738528 GAGATAATGAAGGCCAATGAGGG + Intergenic
1143982248 17:10880090-10880112 GGGAAAATGAAGGTCAGAAAAGG - Intergenic
1146223503 17:31047077-31047099 GAGATAAAGAAGGCCCTGGAAGG + Intergenic
1146334142 17:31954703-31954725 GGAATAATGACGATCAGGGAAGG + Intronic
1147026232 17:37586775-37586797 GGGACAGTGAAGGGAATGGAGGG - Intronic
1149588506 17:57810170-57810192 GGGATAATGCTGGTCCAGGAGGG + Intergenic
1150327409 17:64268200-64268222 GGGATGATGAAGGGCTTTGAGGG + Intergenic
1150449149 17:65251382-65251404 GGGAAAATGAAGATCCAGGAGGG + Intergenic
1150561502 17:66299394-66299416 GGGTTAATGAAGGCCCTGGTTGG - Intergenic
1151996413 17:77612074-77612096 GGCAGAAGGAAGGTAATGGAAGG - Intergenic
1153525502 18:5991200-5991222 GAGAGAATGAAAGTCATGTACGG - Intronic
1156539059 18:37892100-37892122 GAGATAATGGAGGCCAAGGATGG - Intergenic
1159036958 18:63286652-63286674 GGCATTCTGAAGGTCATTGAAGG + Intronic
1159095595 18:63897907-63897929 GGGCTAACTAAGTTCATGGATGG - Intronic
1159172382 18:64788152-64788174 GGGAGACTGGAGTTCATGGAAGG + Intergenic
1160877175 19:1302153-1302175 GGGAAACTGAAGCCCATGGATGG - Intergenic
1160979508 19:1810562-1810584 GGGATTATGAAGTTCAGGGCTGG - Intronic
1163014979 19:14449287-14449309 GGGTTAGAGGAGGTCATGGAGGG - Intronic
1164150521 19:22546356-22546378 GGGATTCTGAAAGGCATGGATGG + Intergenic
1165282436 19:34808868-34808890 GGGATTTTTAAGATCATGGAAGG - Intergenic
1165649536 19:37473593-37473615 GGGATAATTGAGGTTATGAAGGG + Intronic
926792160 2:16584871-16584893 GGGAAACAGAAGGCCATGGAAGG - Intronic
927320824 2:21743776-21743798 GGGATAATGCAGGGAAGGGAAGG - Intergenic
927591853 2:24363448-24363470 AGGATGATGAAGGTCCTGGGCGG - Intergenic
929029744 2:37639325-37639347 GAGATAATGAAGGTTATTGTTGG - Intergenic
930479180 2:51925790-51925812 GGATTAATGAAGGCCCTGGAAGG - Intergenic
930888665 2:56357617-56357639 GGGACATTGTAGGTCATGGAAGG + Intronic
931132444 2:59351743-59351765 GGGATTATCAAGCTCAAGGAGGG - Intergenic
932549517 2:72753702-72753724 GAGATAATGCTGGACATGGAGGG - Intronic
935984806 2:108662188-108662210 GGGAGAAAGAAGGTGACGGAGGG - Intronic
936137243 2:109905839-109905861 GGGAGAAAGAAGGTGACGGAGGG - Intergenic
936207454 2:110465646-110465668 GGGAGAAAGAAGGTGACGGAGGG + Intronic
941871503 2:170390500-170390522 GGGATAAAGAATGTCACAGAAGG + Intronic
942725286 2:178999840-178999862 GGGAGGATGAGGGTCAGGGAAGG - Intronic
944928885 2:204495595-204495617 GGAATAATTAAGCTCAGGGAAGG + Intergenic
945791451 2:214310579-214310601 GCCCTAATGAAGCTCATGGAGGG + Intronic
945798241 2:214391293-214391315 AGGAAAATGAAGGTCAAAGAAGG + Intronic
945951618 2:216044353-216044375 AGGACAATGAAAGGCATGGAAGG - Intronic
946409206 2:219508106-219508128 GAGATAATGAAGGTCTGGGCTGG - Intergenic
947088873 2:226487331-226487353 GGGATAATGAAAGTGAAAGAGGG + Intergenic
1169157064 20:3340694-3340716 GGACTTATTAAGGTCATGGAAGG - Intronic
1169934600 20:10870015-10870037 GGGATAATGGTGGTGATGGAAGG - Intergenic
1171014638 20:21529112-21529134 GGGATGATGAAGATCACAGAAGG + Intergenic
1172972635 20:38884600-38884622 GTCCCAATGAAGGTCATGGAAGG + Intronic
1174591732 20:51650669-51650691 GGGAGAATGGAAGTCAGGGAAGG + Intronic
1175444834 20:59012934-59012956 TGAATAATGACAGTCATGGAAGG + Intergenic
1175579001 20:60084651-60084673 GGATTAATGAAGGTGATGGCAGG - Intergenic
1176290382 21:5041025-5041047 GGCATAATGAAAGTTATGTATGG - Intergenic
1178056768 21:28807867-28807889 GGGAAAATGGAGGGGATGGATGG - Intergenic
1178492098 21:33059071-33059093 AGGATAATGAAGGTCATAATAGG + Intergenic
1178536033 21:33411216-33411238 CGGAAAATGAAGGAAATGGAAGG + Intronic
1178589489 21:33897278-33897300 GGGATAAGAAGGGTCATGGAGGG - Exonic
1179866873 21:44222616-44222638 GGCATAATGAAAGTTATGTATGG + Intergenic
1181411383 22:22722844-22722866 GGTATAATGAAAGTCATTAAAGG + Intergenic
1181667994 22:24411697-24411719 AGGATAAGGTAGGCCATGGAGGG + Exonic
1183913210 22:41094167-41094189 GGGATAATGAAGATGAAGAATGG + Intronic
952125788 3:30299152-30299174 GGCATAATGAAGGGAATGTAAGG + Intergenic
953003609 3:38957579-38957601 GGGCTCATGAAGGTCTTGCAGGG - Intergenic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
958160539 3:89812385-89812407 GGGATAAAGAAAGTAATTGAAGG + Intergenic
960134830 3:114094710-114094732 GCAATAAAGAAGGTAATGGATGG - Intergenic
960346770 3:116542529-116542551 GGGATATTGAATGTTATAGAAGG - Intronic
964361117 3:155897501-155897523 GGTATTATGAAGGCCCTGGATGG - Intronic
964414534 3:156433461-156433483 GGGTTAAGGGAGGTCATGTAAGG + Intronic
967383097 3:188882516-188882538 GTGATAATAAAGTTCATGGAGGG - Exonic
969984409 4:11192559-11192581 GTGATAATTAACGTCAGGGAAGG - Intergenic
970167505 4:13254915-13254937 GAGATAATCAAAGTCATGAATGG + Intergenic
970963711 4:21903260-21903282 TGGATAATGCAGGTCACAGAAGG + Intronic
972110541 4:35553104-35553126 GGGATAATGGAGGAAGTGGAGGG + Intergenic
973235699 4:47901770-47901792 GGGATATTGAAGTTAATTGAAGG - Intronic
974652740 4:64776348-64776370 GGGAAAATGAGGGGCATGGGAGG + Intergenic
974771239 4:66416643-66416665 GTGATAATGAAGGTCACTGGAGG - Intergenic
975186653 4:71411110-71411132 AGGATAACGCAGGTCTTGGAAGG - Intronic
975512594 4:75210271-75210293 GGGATATGGAAGGGTATGGATGG + Intergenic
976455690 4:85244550-85244572 GGGGTACTGAAGGTCATAGTGGG + Intergenic
976897092 4:90126564-90126586 GAGATAAAGAAGGGGATGGATGG + Intergenic
985805793 5:2042187-2042209 GGGATCATGAAAATCATGGCTGG + Intergenic
986835688 5:11634409-11634431 GGGGATATGAAGGGCATGGATGG + Intronic
992058436 5:73017018-73017040 GGGTTAATGTAAGTCATGGTTGG + Intronic
996438906 5:123467274-123467296 GGGATGATGGAGGTCATTGTGGG - Intergenic
996577082 5:124987598-124987620 GGGATGGTGATGGTGATGGAGGG + Intergenic
996860497 5:128060451-128060473 GGGAAAATGAATCTTATGGATGG - Intergenic
997671051 5:135672256-135672278 GGGATATTAAAGGTTATGAAAGG + Intergenic
998420518 5:141980811-141980833 GGAATAATGTAGATCCTGGATGG + Intronic
999142959 5:149374762-149374784 AGGAAACTGAAGATCATGGAAGG + Intronic
1001413845 5:171529249-171529271 GAGATAATGAAGTTCTTGGAGGG - Intergenic
1005713875 6:28528343-28528365 GGGAAACTGAAGGCCAGGGATGG + Intronic
1006294915 6:33165992-33166014 GGAATAAATCAGGTCATGGAGGG + Intronic
1006620334 6:35359535-35359557 GGGCTGAAGAAGGCCATGGAGGG - Intronic
1007251261 6:40496652-40496674 AGGATGATGGAGGTCAGGGAGGG - Intronic
1008627155 6:53327906-53327928 GGGAAAATAAAGTTCAGGGAAGG - Intronic
1010034747 6:71311850-71311872 CAGATAATGAAGGTGAAGGATGG + Intergenic
1012985788 6:105875104-105875126 GAGAGAATCAAGGGCATGGAGGG + Intergenic
1013034779 6:106370662-106370684 AGGAAACTGAAGTTCATGGAAGG + Intergenic
1013654479 6:112231263-112231285 GGGAGAATGCAGGTGATGGATGG + Intronic
1014599717 6:123395588-123395610 GGGACAATGAGGGGCAGGGAAGG - Intronic
1014698926 6:124658851-124658873 GGGAGATTAAAGGTGATGGATGG - Intronic
1014707122 6:124761322-124761344 GGGGTTATCAAGGTCAGGGAGGG - Intronic
1015033092 6:128619752-128619774 GGGATACTGAAGTTAATTGAAGG - Intergenic
1015281928 6:131443271-131443293 GGAATAAAGAAGGTCATTGCAGG - Intergenic
1021845081 7:24756594-24756616 GGGATAATGAAAGGGATGGATGG - Intronic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1022057256 7:26750751-26750773 GGGAAAATGATGTTTATGGAAGG + Intronic
1022174858 7:27863201-27863223 AGGATAATGATGGGCAGGGAAGG - Intronic
1023923696 7:44649587-44649609 GGGACAATGCAGGTTCTGGAAGG - Intronic
1030654858 7:112155736-112155758 CTGCTAATGAAGGTAATGGACGG + Intronic
1030857066 7:114572255-114572277 GAAATAATGAATGTCAAGGATGG + Intronic
1031629136 7:124025018-124025040 GTGATCATGAAGATGATGGATGG + Intergenic
1032282494 7:130515712-130515734 GAGAGAATGGAGGTGATGGAGGG + Intronic
1032703326 7:134400862-134400884 GGGGTAAGGAAGGTTATGGCGGG + Intergenic
1033141925 7:138834913-138834935 GGGAGAATGAAGTTCAGAGAAGG + Intronic
1033358113 7:140617301-140617323 TTGATATTGAAGGCCATGGAGGG - Intronic
1035825447 8:2639845-2639867 AGGATAATGAAGGTCAAGGGGGG + Intergenic
1049091330 8:140516439-140516461 GAGATAATGAAGGCCAGGCATGG - Exonic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1049946393 9:600684-600706 GGGATAATGAAAGTTATGTTGGG - Intronic
1050527207 9:6556316-6556338 GGGGTAGAGAAGGACATGGAGGG + Intronic
1056577059 9:87863526-87863548 TTGAAAAAGAAGGTCATGGAAGG - Intergenic
1057707949 9:97411606-97411628 GGGATAGGGAAAGTCAAGGAAGG + Intergenic
1058446587 9:105060571-105060593 GGGTTTTTGAGGGTCATGGAGGG - Intergenic
1059612310 9:115911791-115911813 GGGAAACTGAAGCTCAGGGAGGG - Intergenic
1059639715 9:116204808-116204830 GGGATAGTGAAGGTGAGAGAAGG - Intronic
1060194855 9:121616958-121616980 GGGACAGAGAAGGTCATGAAGGG + Intronic
1060202710 9:121661064-121661086 GGGAGGATGAGGGTCATTGAGGG + Intronic
1060849957 9:126866400-126866422 GGGACAAGGAAGGCCATGGAAGG - Intronic
1062025420 9:134338088-134338110 GGGCTCAGGAAGGGCATGGAGGG + Intronic
1062489530 9:136798619-136798641 GGGACAATCCAGGACATGGAGGG + Intronic
1185819534 X:3188746-3188768 GGGATAAAGAAGGTGATGTGGGG - Intergenic
1185916061 X:4036792-4036814 TGAATATTGAAGGTCATGGTGGG - Intergenic
1186262188 X:7791412-7791434 GGGATCATCAATGTGATGGAAGG + Intergenic
1186528871 X:10275455-10275477 GGGATAATTAAGCTCAGGGTGGG + Intergenic
1187568494 X:20476512-20476534 GAGTTAGTGAAGGTCATTGATGG + Intergenic
1190490760 X:50980354-50980376 AGCATAATGAAGGGCATGGTTGG - Intergenic
1193214995 X:78853541-78853563 GTAATAAGGAAGGTCATTGAGGG + Intergenic
1195380079 X:104261993-104262015 AGGATCAAGAAGGTCATGAAAGG - Intergenic
1196146372 X:112321711-112321733 AGGATGATGAAACTCATGGATGG + Intergenic
1199254196 X:145699866-145699888 GGAATATTGAATGTCATGAAGGG - Intergenic