ID: 921433425

View in Genome Browser
Species Human (GRCh38)
Location 1:215089047-215089069
Sequence TAGTGTGTAAACAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921433421_921433425 -1 Left 921433421 1:215089025-215089047 CCATGACTTCAAGGATCAAGATT 0: 1
1: 0
2: 0
3: 15
4: 212
Right 921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921433425 Original CRISPR TAGTGTGTAAACAGGGAGGA AGG Intronic
902969032 1:20033352-20033374 TCATGTGTTTACAGGGAGGAGGG + Intronic
903160998 1:21489103-21489125 TGGTCTGGACACAGGGAGGAAGG + Intergenic
903471395 1:23590192-23590214 TGGTGTGTAAGCAGAGAGGCAGG + Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
905116047 1:35641697-35641719 TAGTGTGTAAACAGAGAAACTGG - Exonic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
910575964 1:88764153-88764175 TAGAGTGTAATGAGAGAGGAAGG - Intronic
911848889 1:102789281-102789303 TTGTATGTAAACAGTGCGGAAGG + Intergenic
913300932 1:117367670-117367692 ACGTCTGCAAACAGGGAGGAAGG - Exonic
914713582 1:150235991-150236013 TAGTGTGTGGACAAGGAGGTGGG - Exonic
914944347 1:152050849-152050871 TAGGATGAAAGCAGGGAGGAAGG + Intergenic
916689332 1:167175538-167175560 TAGGGTGACAACATGGAGGAGGG + Intergenic
919713212 1:200749097-200749119 TAGGATGCAAACAGGGAGGAAGG + Intronic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
923797725 1:237174507-237174529 TAGTGGGTGAACAGTGAGGGAGG - Intronic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1065958482 10:30714116-30714138 TAGTGAATACACAGAGAGGATGG - Intergenic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1070361839 10:75698165-75698187 TGGGGTGGGAACAGGGAGGAAGG - Intronic
1073722300 10:106186638-106186660 TTGTGTGTATACAGGGAATATGG + Intergenic
1074257843 10:111821225-111821247 TAGTGTGTAGACATGGACTATGG + Intergenic
1076618724 10:131773348-131773370 TTGTAAGTAAACAGGGAGGGAGG + Intergenic
1078909900 11:15721142-15721164 TAGTGTGTATCCATGGAGCAGGG - Intergenic
1078910039 11:15722702-15722724 TAGTGTGTATCCATGGAGCAGGG - Intergenic
1080939115 11:36894832-36894854 TAGTGTGTAAAGGGGGAAAAAGG + Intergenic
1083682311 11:64357273-64357295 GAGTGTGTGGACAGGGGGGATGG + Exonic
1085068432 11:73519419-73519441 TAGAGTGTAAACTCTGAGGATGG - Intronic
1087999838 11:104864510-104864532 TAGTGTGGAGAGTGGGAGGAGGG - Intergenic
1094057325 12:26280553-26280575 TAATGTGTACACAGGGATGTAGG + Intronic
1094063787 12:26342234-26342256 TAATGTGTGAACTGGTAGGAAGG + Intronic
1094208492 12:27865894-27865916 TAAAGTGCAAACAGGGAAGAAGG + Intergenic
1094727125 12:33131843-33131865 TAGTGTGTAAACTGTGAAGGTGG + Intergenic
1095154645 12:38837610-38837632 TAATGGGTAAACAGGGAGGCTGG + Intronic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1100178963 12:92062796-92062818 TAGTCCGTAAACAGTGAGGAAGG + Intronic
1102089743 12:110175971-110175993 TGGTGTGTAAAGAAGGAGGCTGG - Intronic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1104455310 12:128906484-128906506 GAGTGTGAAAACAGGCATGAGGG - Intronic
1105764992 13:23550404-23550426 AAAGGTGTTAACAGGGAGGAAGG + Intergenic
1106384712 13:29272972-29272994 GAATGTGGAAACAGGGAGGAAGG + Intronic
1106601209 13:31188607-31188629 TAGTGGCAAAACAGAGAGGAGGG - Intergenic
1107740530 13:43445489-43445511 TAGTGTTAAAACAGGGAACATGG + Intronic
1107752248 13:43580685-43580707 TTGCGTGCAAACAGTGAGGAAGG - Intronic
1107938242 13:45363017-45363039 TGGGGTGGAGACAGGGAGGATGG - Intergenic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1108620429 13:52177762-52177784 AAGTGTGTAAACAGGTAGGCTGG - Intergenic
1108666322 13:52635292-52635314 AAGTGTGTAAACAGGTAGAGTGG + Intergenic
1109496839 13:63182421-63182443 TATGGTTTAAACTGGGAGGAAGG + Intergenic
1110545205 13:76748352-76748374 GAGTGTGTGAATAGGGAGAAAGG - Intergenic
1111537073 13:89616283-89616305 TAGTATCTAAACAGAGAGGCAGG + Intergenic
1112276260 13:98023633-98023655 TAGTGTTTAAACTGGAAGGTAGG - Exonic
1114877737 14:26742863-26742885 TATTTTGTAACCAGTGAGGAAGG - Intergenic
1116162200 14:41282223-41282245 GAGAGTGTAAACAGGCAGAAAGG + Intergenic
1116282779 14:42929391-42929413 AAGAGTGAAAGCAGGGAGGATGG - Intergenic
1116480118 14:45387044-45387066 TGGTGTGGCAACTGGGAGGATGG - Intergenic
1117626813 14:57648974-57648996 AAGTGTGCAGACAGGAAGGAAGG - Intronic
1119665920 14:76484923-76484945 TAGTGTGTACACCGGGTGAATGG + Intronic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121980999 14:98453482-98453504 GAGTGTGTAAGCAGAGAGGGAGG - Intergenic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1124041751 15:26111787-26111809 TAGAATGTAAATAGGGAGAAAGG + Intergenic
1124477887 15:30051216-30051238 TAGGATTTAAACAGGGAGGAAGG - Intergenic
1125812530 15:42553754-42553776 TAGTGTGTAAGCATGGAGAGAGG + Intronic
1126809218 15:52383751-52383773 TAGTGCCTGAACAGGGAGTAGGG - Intronic
1130275058 15:82472182-82472204 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130467407 15:84199551-84199573 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130496853 15:84473984-84474006 GAGTGGGCAAACAGGGAAGAAGG + Intergenic
1130589702 15:85204149-85204171 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130649738 15:85755761-85755783 TGGTGGGGAACCAGGGAGGATGG - Intergenic
1130912301 15:88279154-88279176 AAATGTGTAAACATGGAGGCAGG - Intergenic
1132071692 15:98783323-98783345 TAGTTTGTAACCAGGCATGAAGG - Intronic
1132379586 15:101357551-101357573 TATTGTGTACACAGGGAGGCAGG - Intronic
1133453816 16:5925073-5925095 TGGTGTGGAAACAGGGAGGGTGG - Intergenic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1136156060 16:28383063-28383085 TTATGTGTAATCAGGGAGCAAGG + Intronic
1136207026 16:28732225-28732247 TTATGTGTAATCAGGGAGCAAGG - Intronic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1138416154 16:56872531-56872553 TTGTGTGGACACTGGGAGGATGG + Intronic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1144079187 17:11747170-11747192 TGCTGTGGAAACAGAGAGGAGGG - Intronic
1144464472 17:15486023-15486045 AAGTGTGGAACCAGGGAGGCTGG - Intronic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1145414701 17:22704727-22704749 TACTGTGTGAAGAGGCAGGATGG + Intergenic
1146483489 17:33224586-33224608 GCATGTGGAAACAGGGAGGAGGG + Intronic
1146675232 17:34768737-34768759 CAGTGTGTAAAAAGGAAGCAAGG - Intergenic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147573468 17:41585687-41585709 TAATGTGGGAGCAGGGAGGAGGG + Intronic
1148027690 17:44599960-44599982 CAGTGTGTAACCCGAGAGGATGG - Intergenic
1149347585 17:55753743-55753765 TCGTCTGTATACAGGGAAGATGG - Intronic
1149658145 17:58320855-58320877 TAGGGGGGAAACTGGGAGGATGG - Intronic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1153571680 18:6479453-6479475 TAGGGTGGAAAGAGGTAGGAGGG + Intergenic
1156920207 18:42513135-42513157 TAGTGTGGAAAGAAGGAGCAGGG + Intergenic
1158171157 18:54602519-54602541 AAGCATGAAAACAGGGAGGAAGG + Intergenic
1159032597 18:63246674-63246696 TAGGGTGTAACTGGGGAGGATGG - Intronic
1159916052 18:74188816-74188838 TGAAGTGGAAACAGGGAGGATGG - Intergenic
1160599025 18:79998478-79998500 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1160602927 18:80028097-80028119 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1161239677 19:3215221-3215243 TAGCGTGGAATCAGGGAGGCTGG - Intergenic
1161323400 19:3651730-3651752 AAGTGTGAAAACAGGCAGGGAGG - Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1163332166 19:16646703-16646725 TAGTGTCTATACAGGAAGGCTGG + Exonic
1164774491 19:30842373-30842395 TACTGTGTTTACAGGGAGGTCGG - Intergenic
1164776502 19:30857460-30857482 TAGGGTGTAGTCAGGGAGGCTGG - Intergenic
1164855783 19:31519625-31519647 TAATTTTTAAACAGGGATGATGG - Intergenic
1164962777 19:32449740-32449762 TAGTGTGTACAGTGAGAGGAAGG - Intronic
1165204389 19:34171806-34171828 TAGAGGGGAAACAGGGAGCATGG + Intergenic
1165251561 19:34540671-34540693 TGGTTTGTAAGTAGGGAGGATGG - Intergenic
1165810643 19:38609796-38609818 TAGGGGGAAAACAGGGAGGGAGG - Intronic
1166014141 19:39967426-39967448 AAGCCTGGAAACAGGGAGGATGG + Intergenic
1167952165 19:53036587-53036609 GGGGGTGTAAACAGGGAAGAGGG - Intergenic
926778043 2:16441415-16441437 CAGTCTGGAAGCAGGGAGGAAGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
932487325 2:72092065-72092087 CAGTGTGGAAACTGGGAGGGAGG - Intergenic
933256525 2:80087335-80087357 TACTGAGAAAACAGGTAGGAAGG + Intronic
933280412 2:80326884-80326906 AAGTGTGTAAAAGGGAAGGAGGG - Intronic
933898874 2:86835316-86835338 TGGTTTGGAAACAGGGAGGTAGG - Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935781674 2:106513910-106513932 TGGTTTGGAAACAGGGAGGGAGG + Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937425652 2:121796467-121796489 TAGTGTTTAATCAGGGGAGATGG - Intergenic
939846613 2:147254647-147254669 TCTGGGGTAAACAGGGAGGAAGG + Intergenic
941208455 2:162604771-162604793 TAGTATGAAAAAAGGGAGCAGGG - Intronic
943517035 2:188901613-188901635 TAGTGTATAAACTTGGAGTAGGG + Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944750361 2:202703164-202703186 TAGTGAGGAAAAAAGGAGGATGG - Intronic
948574969 2:238943995-238944017 TAGGTTTTAACCAGGGAGGAGGG - Intergenic
1172980866 20:38940565-38940587 TACTGTGGAAATGGGGAGGAAGG + Intronic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173398367 20:42702040-42702062 AAGTGGGTAAACAGAGAGGGAGG - Intronic
1182018429 22:27060643-27060665 GAATGTGTAAACAGGAAGGGAGG + Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183025950 22:35066086-35066108 TACTGTGTAACCAAGGAGGAGGG - Intergenic
1184510459 22:44930340-44930362 AAATGGGTAAACAGGGAGGTTGG - Intronic
1184529526 22:45046067-45046089 TAGTGGGTAAACAGTGAACATGG - Intergenic
1185129628 22:49031820-49031842 TAGAGGGAAGACAGGGAGGAAGG - Intergenic
950890044 3:16396552-16396574 TAGAGTGAAAAAAGAGAGGAGGG + Intronic
952083992 3:29795700-29795722 TCCTCTGTAAACTGGGAGGAAGG + Intronic
952398060 3:32938578-32938600 TAGTTTGTATACAGGTAGGTGGG + Intergenic
954536148 3:51360830-51360852 TACTGTGGGAACATGGAGGAGGG + Intronic
958004791 3:87797219-87797241 TAGTGTGTATACAGAGAGTTTGG + Intergenic
958159277 3:89796046-89796068 TAGTGTGTAAAAAAAGAGTAAGG - Intergenic
960737863 3:120800107-120800129 TGCTGAGTAAACAGGGAGGTTGG + Intergenic
960811302 3:121629917-121629939 GACTGTGTACACAGGGAGGGAGG + Exonic
961388484 3:126537844-126537866 TTGTCTGTAAACAGGGACAACGG - Intronic
961558794 3:127714733-127714755 GAGTGTGCAAAGAGGCAGGAGGG + Intronic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
961719272 3:128881706-128881728 AAGTGCGTCAACAGGGTGGAAGG - Intronic
961838625 3:129687072-129687094 AGGTCAGTAAACAGGGAGGAGGG + Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
963063974 3:141247845-141247867 TGGTGTGTAAACAAGGATCATGG + Intronic
963202602 3:142600209-142600231 TTGAGTGTACACAGTGAGGAGGG + Intronic
964624664 3:158747757-158747779 TACTGTGGAAACAGAGAGCACGG - Intronic
964873212 3:161336092-161336114 TTGTGTGTTGACAGTGAGGAAGG + Intergenic
966311059 3:178594371-178594393 TAGTGTGGAAGCAGTGAAGATGG + Intronic
966407401 3:179612100-179612122 TAGTGTGTAACCAGGAATGGTGG - Intronic
967381964 3:188868949-188868971 AAGTGTGCAGACAGGGAGAAAGG + Intronic
971361672 4:25943805-25943827 TAATGTGTAAAGAGTGAGGGAGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
978080674 4:104587299-104587321 AAGTGTGTAAACAGAGGAGAAGG - Intergenic
980101156 4:128542818-128542840 TTGTGTGGAAGCAGGGAGGCTGG - Intergenic
985257048 4:188080710-188080732 TAGTGTGGTCAAAGGGAGGATGG + Intergenic
987761758 5:22172654-22172676 TAGTCTCTAAACAGGGAAGAGGG + Intronic
988018864 5:25597437-25597459 TTGTGAGAAAACAGTGAGGATGG - Intergenic
988926779 5:35998201-35998223 TCGTGTGCAAAAAGGGAGAAAGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991896542 5:71406093-71406115 TAGTCTCTAAACAGGGAAGAGGG + Intergenic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996208791 5:120778961-120778983 AAATGTTTAAACAAGGAGGAGGG + Intergenic
997713752 5:136027638-136027660 GAGTCTGTATACAGGGAGAAGGG - Intergenic
998207210 5:140166434-140166456 TAGGGTGCAGACAGGGAGGCAGG + Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999042589 5:148431265-148431287 TTGTCTCTAAACAGGGAGGGAGG + Intronic
999753344 5:154646661-154646683 TGTTTTGTAAACAGGGATGAAGG + Intergenic
1000650685 5:163814987-163815009 TAGTGTGGGAGCAGGGAGAAGGG - Intergenic
1001766842 5:174255770-174255792 CAGTGTTTAAACTGGGAGGTAGG + Intergenic
1005926222 6:30447864-30447886 GGGTGGGGAAACAGGGAGGAAGG + Intergenic
1007545505 6:42690681-42690703 TAACGTGTAAAAAGGGAAGAGGG - Intronic
1007611507 6:43152169-43152191 AAATGTGTAACCAGTGAGGAAGG - Intronic
1007912448 6:45529522-45529544 TAGTTTTTAACCAGGGAGAAAGG - Intronic
1008168206 6:48167182-48167204 TAGGCTGTAACCAGTGAGGAGGG + Intergenic
1008390062 6:50940056-50940078 TAGTGGGTAAACAGGAAATAAGG - Intergenic
1009815918 6:68734610-68734632 TATTGTGAACACTGGGAGGATGG + Intronic
1011458084 6:87573806-87573828 TAGAGAGTAAACAGGTAGGTAGG + Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011912261 6:92455443-92455465 CATTGTGTAAACATAGAGGAAGG + Intergenic
1013492411 6:110661008-110661030 TAGTGTGTATACCAGGAGGTGGG - Intronic
1013939351 6:115643395-115643417 GGGTGTGTGACCAGGGAGGAAGG + Intergenic
1016604602 6:145905869-145905891 TAGAGGGTAAACAAGCAGGAAGG - Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017647688 6:156554304-156554326 TAAAGTGAAAACAGGGAGCATGG - Intergenic
1017755461 6:157525646-157525668 GAGTGTGAAAACCAGGAGGAGGG + Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1019859710 7:3646247-3646269 TAATGTTTAAACATGGAGGTGGG - Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021314039 7:19124167-19124189 TAGGTTGCAAACAGGCAGGAAGG + Intergenic
1021948563 7:25752541-25752563 TAGAGTGGAAATAGGGCGGAGGG - Intergenic
1022337035 7:29431741-29431763 TATTGGGCAATCAGGGAGGAGGG + Intronic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023624700 7:42104401-42104423 CAGTGGGTAAACAGGCAGGGCGG + Intronic
1023946364 7:44806139-44806161 TAGTGTGTAAACACCCAGCAGGG + Intronic
1024388290 7:48778634-48778656 TAGTCTGAAAACTGGGAGGCTGG + Intergenic
1027831072 7:83178519-83178541 TAGTGAGCAAAAAGGGAGGTAGG + Intergenic
1030366649 7:108654383-108654405 GAGGGTGTAAACATGGAGGTTGG + Intergenic
1030389401 7:108907334-108907356 GAGTGAGTAAAAAGGGAGGGGGG - Intergenic
1030797174 7:113803285-113803307 AAGTGTGTGGACAGGAAGGAGGG - Intergenic
1032234556 7:130108836-130108858 TATTGTGTATAAAGGGGGGAAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1038119321 8:24594267-24594289 TAGGGTATCAGCAGGGAGGATGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1039033328 8:33332737-33332759 TCGTGTGTAATGAGGAAGGAAGG + Intergenic
1044097439 8:88085152-88085174 TAGTGTTTAAAAAGAGAGCAAGG + Intronic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1045978861 8:108160760-108160782 AAGTGTGTAGAAAGGAAGGATGG + Intergenic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047668123 8:127114978-127115000 TAGTCTTAAAGCAGGGAGGAGGG - Intergenic
1048512136 8:135072435-135072457 ATGTGGGTAAACAGGAAGGAGGG + Intergenic
1048563127 8:135564110-135564132 TAGTGTGGAAACAGGGAAAGGGG - Intronic
1049596336 8:143485374-143485396 AAGTGGGTCAACAGTGAGGATGG + Intronic
1051133762 9:13894163-13894185 ATGTGTGTAAGCAGGAAGGAGGG + Intergenic
1051261107 9:15265632-15265654 TACTGTATAAAAAGGGAGGAGGG + Intronic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051844768 9:21439173-21439195 TATTGTGTAAATAAGGAGTATGG + Intronic
1052014628 9:23450767-23450789 TAGTGAGTAAACAAGGAAGCGGG - Intergenic
1054799475 9:69333188-69333210 TAGATTGTTAACATGGAGGAGGG + Intronic
1055601174 9:77920371-77920393 TAGTGTGTAAACTGGCAGTGTGG + Intronic
1055748210 9:79474196-79474218 TTTTGTGAAAACAGGGAGTATGG - Intergenic
1056722482 9:89083550-89083572 CAGTGTGTAGACAGGCAGAAAGG + Intronic
1058107419 9:100988549-100988571 TAGAGAGTAAAGAGAGAGGAGGG + Intergenic
1058597676 9:106632206-106632228 GAGGGTGCAATCAGGGAGGAAGG + Intergenic
1060443006 9:123659131-123659153 TAGTGTGCAAAAAGAGAGGAAGG - Intronic
1061278577 9:129583868-129583890 TAGTGATTAAACAGGGATGGTGG + Intergenic
1186855467 X:13621946-13621968 GAGTGTGTAAATTGGGATGATGG - Intronic
1188147569 X:26632286-26632308 TTTTGTTTAAACAGAGAGGAAGG + Intergenic
1189701724 X:43719866-43719888 TAGTGGGGAAACAGGAAGGTTGG + Intronic
1197895471 X:131309009-131309031 TAGTTTGTAAAGAGGGAGTAAGG + Intronic
1198999739 X:142620696-142620718 AAGTGTGGAAACAGAGAGGCAGG - Intergenic
1199157277 X:144565301-144565323 TAGAGGGAAATCAGGGAGGAAGG - Intergenic
1199825835 X:151498415-151498437 TGGTGTGTGGACAGGGAGGGAGG + Intergenic
1201944287 Y:19495466-19495488 GTGTGTGTAGACAGGCAGGAGGG - Intergenic