ID: 921435735

View in Genome Browser
Species Human (GRCh38)
Location 1:215118817-215118839
Sequence AATTCTGAACTGCAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921435735_921435737 28 Left 921435735 1:215118817-215118839 CCTTGTACCTGCAGTTCAGAATT 0: 1
1: 0
2: 1
3: 16
4: 187
Right 921435737 1:215118868-215118890 ATTAATGTGATTCTACTTTTAGG 0: 1
1: 1
2: 1
3: 53
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921435735 Original CRISPR AATTCTGAACTGCAGGTACA AGG (reversed) Intronic
901863968 1:12091889-12091911 TATTGTGAACTGCACGTGCAAGG - Intronic
901915859 1:12499299-12499321 AATGCTGAACTGCAGCTATCTGG - Intronic
902827234 1:18984770-18984792 AAAGCTGAATCGCAGGTACATGG + Intergenic
908314781 1:62922063-62922085 AATTCTGAATTCCAGGAAGATGG - Intergenic
909809911 1:79919933-79919955 TATTCTGATCTACAGGAACATGG + Intergenic
909838343 1:80286147-80286169 AATTCCCAACTCCAGGTTCAAGG + Intergenic
912678910 1:111715537-111715559 TTTTCTGAACTGCAGCTGCATGG + Exonic
915636143 1:157188197-157188219 AATTCCAAAGTGGAGGTACAGGG - Intergenic
916439811 1:164812818-164812840 AATTCTGAACTGATGACACAAGG - Intronic
917063138 1:171062836-171062858 AATATTGAGCTGCAGGTACAGGG + Intronic
917169678 1:172157243-172157265 AATTGTGAACTGCACATGCAAGG - Intronic
917620655 1:176792314-176792336 AATTCTGAACTGCATTAGCAAGG + Intronic
918265188 1:182835927-182835949 TATTGTGAACTGCAGATGCAAGG - Intergenic
918623393 1:186630926-186630948 ATTTCTGGATCGCAGGTACAGGG - Intergenic
921435735 1:215118817-215118839 AATTCTGAACTGCAGGTACAAGG - Intronic
921450587 1:215301322-215301344 AATTCTGAATCTCAGGTAGATGG - Intergenic
923377355 1:233377899-233377921 CATTGTGAACTGCACATACAAGG - Intronic
924501633 1:244643815-244643837 TATTGTGAACTGCACGTGCAAGG + Intergenic
924844556 1:247752458-247752480 AATACAGAACAGCAGATACAAGG - Intergenic
1063811760 10:9718998-9719020 AATTCTGAAAAGCAAGTACAAGG + Intergenic
1063926297 10:10981016-10981038 AATCCTGAACTGCTAGTGCAGGG + Intergenic
1064852668 10:19726968-19726990 AACTCTGAACTGAAGCTCCATGG - Intronic
1066039180 10:31528392-31528414 ATGTCTGAAATGCAAGTACATGG - Exonic
1068267496 10:54672035-54672057 TATTGTGAACTGCACATACAAGG + Intronic
1068475631 10:57520809-57520831 AGTTCTGAACTGCAGTTTGAGGG - Intergenic
1068500177 10:57834249-57834271 TATTCTGATCAGCAGGTCCAGGG + Intergenic
1072030138 10:91511655-91511677 TATTGTGAACTGCACGTGCAAGG - Intronic
1072659065 10:97351399-97351421 GCTTCTGAACAGCAGGTAAATGG + Intergenic
1073741517 10:106413053-106413075 TATTGTGAACTGCACGTGCAAGG + Intergenic
1075383261 10:122036108-122036130 AATTCTGACATGCAGCAACATGG - Intronic
1076299114 10:129411386-129411408 AAGGCTGCACTGCAGGTACCAGG - Intergenic
1077866930 11:6230150-6230172 ACCTCGGAACTGCAGATACAGGG + Intronic
1078038319 11:7832494-7832516 AATTTTGACCTACAGTTACATGG + Intergenic
1080831994 11:35903485-35903507 TATTGTGAACTGCACATACAGGG - Intergenic
1080952639 11:37053412-37053434 ATTTCTTTACTTCAGGTACAAGG + Intergenic
1081150429 11:39622422-39622444 AAATCTGATGTGCAGTTACATGG - Intergenic
1083051597 11:59781959-59781981 AATGCTCAACTAGAGGTACAAGG + Intronic
1085848099 11:80088672-80088694 AGTTGTGAACAGCAGCTACATGG + Intergenic
1086486056 11:87303246-87303268 CATTGTGAACTGCGCGTACAAGG + Intronic
1086989140 11:93283783-93283805 GATTTTGAACTGCATGTAAACGG + Intergenic
1088075820 11:105847221-105847243 TATTGTGAACTGCACATACAAGG - Intronic
1089923187 11:122229914-122229936 AACTTTGATCTGCAGGTAAACGG - Intergenic
1091576914 12:1745940-1745962 AATTTTGGACTACAGGTACAAGG - Intronic
1092010171 12:5103383-5103405 AGTGCTGAACTCCAGGTAAAAGG - Intergenic
1093176978 12:15923442-15923464 AGGTCTGAACTGCAAGCACAGGG - Intronic
1100920423 12:99478470-99478492 ACATCTGAACTGTATGTACATGG - Intronic
1101097182 12:101354579-101354601 AACACAGAACTGCAGGTACAGGG - Intronic
1101450136 12:104768500-104768522 ATTTCAGAACTGCAGATAAAGGG - Intergenic
1101733103 12:107442896-107442918 AATTCTGAAGTCCAGGATCAAGG + Intronic
1101867746 12:108534315-108534337 AATTGTGAACTGCAGATCTAGGG + Intronic
1105203864 13:18202961-18202983 TATTGTGAACTGCACATACAAGG + Intergenic
1106026251 13:25958412-25958434 AATCCTGATCCGCAGGTGCATGG + Intronic
1108020946 13:46127149-46127171 AATGCTGACCTCCAGGAACAGGG + Exonic
1108455114 13:50605395-50605417 CATGCTAAACAGCAGGTACAAGG - Intronic
1110011205 13:70336313-70336335 AATTTTGAAATCCAGGTAGAGGG - Intergenic
1110477066 13:75928511-75928533 TATTGTGAACTGCACGTACAAGG + Intergenic
1110640952 13:77823107-77823129 AAATCTGAACTGCAGGGGGAAGG - Intergenic
1110884240 13:80613213-80613235 AATTTTCAACTGCACGTGCAGGG - Intergenic
1111183726 13:84701548-84701570 TATTGTGAACTGCACATACAAGG - Intergenic
1112670228 13:101627325-101627347 AATACTGAACAGAAAGTACAGGG + Intronic
1114751803 14:25212601-25212623 ATTTCTCAACTGCAGCAACAGGG - Intergenic
1116353914 14:43903333-43903355 AATTCTTCACTGCAGCTATAAGG + Intergenic
1118505665 14:66408383-66408405 AATTCTGAATAGTAGATACATGG - Intergenic
1119754712 14:77107710-77107732 AAATCTGTACTGAAGCTACATGG - Intronic
1124162767 15:27288488-27288510 TATTGTGAACTGCATGTGCAAGG - Intronic
1126661858 15:51040121-51040143 TATTGTGAACTGCATGTGCAAGG + Intergenic
1127249187 15:57212228-57212250 AGTTCTGAACTGCAGTTACATGG + Intronic
1128662749 15:69514115-69514137 TATTGTGAACTGCACGTGCAAGG + Intergenic
1129061418 15:72863408-72863430 AATTCTGAAATGCAGGGTAAAGG - Intergenic
1131432805 15:92400265-92400287 AATTGTGAAATGCATGTCCATGG - Intronic
1134095799 16:11417631-11417653 AGTGCTGAGCTGCAGATACACGG - Exonic
1136291301 16:29273187-29273209 GATGCTGATCTGCAGGTCCAGGG + Intergenic
1139357842 16:66377837-66377859 CATTCTGAATTCCAGGAACAGGG - Intronic
1142097169 16:88246653-88246675 GATGCTGATCTGCAGGTACAGGG + Intergenic
1143809776 17:9461919-9461941 TATTGTGAACTGCACATACAAGG - Intronic
1144665676 17:17100612-17100634 AGTTCTGAACTGCACATGCAAGG + Intronic
1145234761 17:21200687-21200709 CATTCGGAGCTTCAGGTACATGG - Intronic
1148126110 17:45237813-45237835 AGTTCTGAATGGAAGGTACAGGG + Intronic
1156681979 18:39601345-39601367 AATTCTTAACTGCAATCACAGGG - Intergenic
1158289646 18:55925443-55925465 AAACCTGAAATGCAGGTACCAGG + Intergenic
1158481609 18:57826229-57826251 AATTCTCAATAGCAGGTCCATGG + Intergenic
1161688419 19:5715957-5715979 CATTCTCAACGGCAGGTTCAGGG + Intronic
1162541633 19:11300087-11300109 AATCCTGTACATCAGGTACAGGG + Intronic
1164582596 19:29443621-29443643 AATTTTGAACTGCATTTAAATGG + Intergenic
1166745184 19:45138500-45138522 CATTCTGGGCTGCAGGCACAGGG - Exonic
934625786 2:95849748-95849770 TATTGTGAACTGCACGTTCAAGG - Intronic
939921239 2:148116539-148116561 AATTCTGAATTTCATGTACCAGG + Intronic
940180387 2:150925203-150925225 AATTATGAACTCCAGGAGCAAGG - Intergenic
941315035 2:163981476-163981498 AAATCTGTTCTGGAGGTACATGG - Intergenic
942469329 2:176243402-176243424 TATTGTGAACTGCATGTGCAAGG + Intergenic
942596679 2:177598125-177598147 ATCTGTGCACTGCAGGTACAAGG + Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
944534064 2:200692598-200692620 AATTCTGAACATCAGTTACCAGG - Intergenic
945027438 2:205632488-205632510 AATTGTGAACTGCACACACAAGG + Intergenic
945946246 2:215998486-215998508 ACTTCTGACCTGCAGCCACAAGG - Intronic
946159737 2:217828739-217828761 AATTCTGAAAAGCAGTTTCAAGG - Intronic
946995027 2:225381732-225381754 TATTGTGAACTGCACATACAAGG - Intergenic
1170093798 20:12622267-12622289 AATCCTGTCCTCCAGGTACATGG - Intergenic
1172228437 20:33320890-33320912 AATTCTGAACTGCAGCTGATTGG + Intergenic
1173735933 20:45361430-45361452 AATTCTGATTGGCAGTTACATGG + Intergenic
1176714106 21:10335125-10335147 TATTGTGAACTGCACATACAAGG - Intergenic
1177436253 21:21057222-21057244 AATTCACAACAGCAGTTACATGG + Intronic
1178331843 21:31703388-31703410 AATTGTTAACTATAGGTACAAGG + Intronic
1179043349 21:37824444-37824466 AAGTCTGAACTCCAGGTGTAGGG + Intronic
1180577355 22:16791232-16791254 AATTCTCATCTGCAGCAACAGGG + Intronic
1181121860 22:20673821-20673843 AATTCTGAACTGCAGATAATGGG + Intergenic
1181147601 22:20859650-20859672 AATTCTGAACAGCAGGTCCTAGG + Intronic
1181167354 22:20990955-20990977 GAGTGTGAGCTGCAGGTACAGGG + Intronic
1181334726 22:22119066-22119088 AATTCAGAGCTGCAGGTAATGGG - Intergenic
1183784967 22:40023926-40023948 ATTTCAGGACTGCAGGTACTGGG - Intronic
1184128557 22:42503677-42503699 AAATGTGAACTGAAGGAACAAGG + Intergenic
1184137351 22:42556992-42557014 AAATGTGAACTGAAGGAACAAGG + Intronic
952266099 3:31787787-31787809 TATTCTGAACTGCACCTAGAAGG - Intronic
952646109 3:35660988-35661010 ATTTCTTAAAGGCAGGTACAGGG + Intronic
953805889 3:46066971-46066993 GACTCTGTACTGCAGGTATATGG - Intergenic
953980821 3:47412184-47412206 CATTGTGCACTGCAGGTAGAGGG + Exonic
955809613 3:62773429-62773451 AATTCTGAAATGCAAGTTGAAGG + Intronic
955815637 3:62839502-62839524 TATTCTGAACTCCAGTGACAGGG - Intronic
955919585 3:63941409-63941431 TATTGTGAACTGCACGTGCAAGG + Intronic
956357095 3:68405853-68405875 AATTCTGAAATGCTGGAAAATGG - Intronic
956389258 3:68753945-68753967 ACTTCTGACCTGCAGAAACATGG + Intronic
957613786 3:82503328-82503350 TATTGTGAACTGCACATACAAGG - Intergenic
962574635 3:136745535-136745557 TATTGTGAACTGCACATACAAGG - Intronic
963780724 3:149483586-149483608 TATACTGAACTGCAGGTATAAGG + Intronic
965428299 3:168554917-168554939 CATGCAGAACTGCAGGTCCATGG - Intergenic
965476440 3:169161418-169161440 AATTCTGAACTGTTGGCTCAGGG - Intronic
967042041 3:185702781-185702803 ACTTGTGAACTGCAGGTGGAGGG - Intronic
967388694 3:188934396-188934418 AATTCTGAACTGAGGGTATGTGG + Intergenic
967919558 3:194604279-194604301 AACTCCGACCTGGAGGTACACGG - Exonic
971544173 4:27863617-27863639 AATTCTGAACTACATTTAAAAGG - Intergenic
971974726 4:33669339-33669361 AATTTTAAACTGCAGGTAAAGGG - Intergenic
972268274 4:37483787-37483809 ACTTCTGGACTGCTGGCACAGGG - Intronic
973968529 4:56187983-56188005 AATTCTGAACTGCAGTTCAGAGG + Intronic
974369066 4:60990262-60990284 ACTTCTGAGCTGCAGGAACTTGG + Intergenic
975576701 4:75870214-75870236 AGTTCTGCACTCCAGGTACCAGG + Intronic
976048966 4:80987985-80988007 AATTCACAACTGCAGAGACATGG - Intergenic
976716682 4:88130293-88130315 TATTGTGAACTGCATGTACGAGG + Intronic
976944228 4:90744741-90744763 TATTGTGAACTGCACGTACAAGG + Intronic
977235164 4:94499833-94499855 TATTGTGAACTGCACGTGCAAGG + Intronic
977441775 4:97076797-97076819 CATTCTGAACTGCAGCTACCAGG + Intergenic
980910848 4:138993008-138993030 TATTGTGAACTGCATGTGCAAGG + Intergenic
982731570 4:158961273-158961295 CATTCTGAACTGAAGCTTCAGGG - Intronic
982881654 4:160726467-160726489 AATTCTGAACTCCAGATTCCAGG + Intergenic
986276684 5:6281371-6281393 AATTCTGAACTGTAGCTCCATGG - Intergenic
986418865 5:7556770-7556792 TATTATGAACTGCACGTGCAAGG + Intronic
986693073 5:10330135-10330157 AAATCTGAGCTGCACGCACAAGG - Intergenic
992559809 5:77939869-77939891 AATATTGAACAGCAGGTATATGG - Intergenic
992956451 5:81914379-81914401 AATTCAGAAATGCAGGTAATTGG - Intergenic
994450271 5:99931984-99932006 ATTTGAGAACTGCAGCTACAGGG - Intergenic
994919657 5:106027610-106027632 AACTCTGAACTCTAGGAACAAGG + Intergenic
997039215 5:130232380-130232402 TTTTCTGAAATGCAGTTACAAGG + Intergenic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
997698095 5:135877465-135877487 AAACCTGAACTGCAGGCACCAGG + Intronic
998291884 5:140923978-140924000 AATTCTGAGCTGCACCTAGAGGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998923294 5:147094934-147094956 AATTCTGTCCTACATGTACAAGG + Intergenic
1001670766 5:173471835-173471857 ACTTCTCATCTGCATGTACAAGG - Intergenic
1001762077 5:174215796-174215818 AATATTGAGCTGTAGGTACAGGG + Intronic
1002110438 5:176906283-176906305 AATTCTGGACTTGAGGAACAAGG + Intronic
1004743318 6:18485113-18485135 ATTTAGGAACTGCAGATACAAGG + Intergenic
1006559350 6:34896423-34896445 AATTCCAAAATGCAGGAACAGGG - Intronic
1007954308 6:45902354-45902376 AATTCTAAACTGCAGTGACTGGG - Exonic
1008950816 6:57156863-57156885 TATTGTGAACTGCACGTACAAGG - Intronic
1011108992 6:83815211-83815233 AATTCTAACCTACAGCTACAAGG - Intergenic
1013264297 6:108479601-108479623 ATATCTGAATTGCAGTTACAAGG - Intronic
1013496211 6:110700091-110700113 CATTATGAACTGCATGTGCAAGG + Intronic
1014916399 6:127154694-127154716 AATGCTGATTTGCAGGTACTGGG - Intronic
1015509178 6:134020766-134020788 AATTTACAACTGCAGGTGCAAGG - Intronic
1018515393 6:164574116-164574138 TATTGTGAACTGCACATACAAGG - Intergenic
1022523407 7:31022282-31022304 GATTCTGAACAGCATGTACTAGG + Intergenic
1022604261 7:31793002-31793024 AATCCTGAAGTGCAAATACATGG + Intronic
1024507200 7:50171944-50171966 CTTTGAGAACTGCAGGTACAGGG + Intergenic
1024870930 7:53961124-53961146 TATTCTGATCAGCAGGTCCAGGG - Intergenic
1026260134 7:68747890-68747912 TATTGTGAACTGCACGTGCAAGG - Intergenic
1027482888 7:78720975-78720997 AAATCTGAAATGGAGATACAGGG + Intronic
1028033852 7:85953876-85953898 AAAAATGAACTGCAGGTAGAAGG + Intergenic
1029136618 7:98377294-98377316 AATTCTTACCTGTATGTACAAGG - Intronic
1029166800 7:98597391-98597413 ATTTCTGAAATGCAGCTTCAAGG - Intergenic
1030171831 7:106610225-106610247 TATCCAGAACTCCAGGTACAAGG + Intergenic
1031221830 7:118976405-118976427 TATTGTGAACTGCACATACAAGG - Intergenic
1032916002 7:136490894-136490916 AGTTCTGAGCTGCAGTTAAAGGG - Intergenic
1034692875 7:153028077-153028099 GATTCTGAACTCCAGCTTCACGG + Intergenic
1034700058 7:153087972-153087994 TGTTCTGAACTGCATGTTCAGGG - Intergenic
1037337934 8:17809776-17809798 TATTGTGAACTGCACATACAAGG + Intergenic
1039750782 8:40476272-40476294 AATTCTAAACTGCAGATGGATGG - Intergenic
1040898406 8:52391883-52391905 AATTCTGAATGGCAGGAAAAGGG + Intronic
1043931743 8:86099227-86099249 AAATCTGGACTGCAGGAATAAGG - Intronic
1046062691 8:109158076-109158098 TATTGTGAACTGCACGTGCAAGG - Intergenic
1048738189 8:137525032-137525054 AATTATGTTCTGCAGGTATAAGG + Intergenic
1051879647 9:21826926-21826948 AATTGTGAACTGCACGTGGAAGG + Intronic
1055074031 9:72195231-72195253 AATTCTCAATTGAAGATACAAGG - Intronic
1056316780 9:85397886-85397908 AATTTTGGAGTGCAGGTACTAGG + Intergenic
1056419139 9:86406807-86406829 ATTTCTCAAATGCAGGTTCATGG + Intergenic
1058665346 9:107309192-107309214 AATTCTGATTTACAGGTCCAGGG - Intronic
1060608931 9:124942443-124942465 AGTTCTGACCTGCAGGAGCAGGG + Intronic
1061649895 9:132039065-132039087 AATTTTGAAGTCCAGGTTCAAGG - Intronic
1185510054 X:657288-657310 AAATCTGCCCTGCAGTTACAGGG - Intronic
1185907928 X:3953996-3954018 AAAAATGAACTGCAGGTGCATGG + Intergenic
1186237567 X:7529987-7530009 AATTTTGCACTACAGGTAAATGG - Intergenic
1190397178 X:49997068-49997090 AATGCTGAACTACTGATACAAGG - Intronic
1192016325 X:67335550-67335572 AATTCTGAACCTCAGATCCAAGG + Intergenic
1192590922 X:72358867-72358889 TATTGTGAACTGCATGTGCAAGG - Intronic
1194733211 X:97480369-97480391 AATTCTGAAGTTAAGGTACAGGG - Intronic
1195713474 X:107795003-107795025 AATTTTGGGCTGCAGGAACATGG - Intergenic
1196115001 X:111989749-111989771 AATACTGAACTGCAGTTAAAAGG + Intronic