ID: 921441015

View in Genome Browser
Species Human (GRCh38)
Location 1:215186136-215186158
Sequence GGCTGGGTATGGTGGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921441015 Original CRISPR GGCTGGGTATGGTGGCAAAA TGG Intronic
900557694 1:3288518-3288540 GGCCAGGAGTGGTGGCAAAAGGG + Intronic
901335886 1:8448610-8448632 AGCTGGGCATGGTGGCTAATAGG + Intronic
903277896 1:22233249-22233271 GGCTGGGTGTGGGGGCAAAACGG + Intergenic
903679612 1:25088282-25088304 TGCTGGGGAGGGTGGGAAAAGGG + Intergenic
903846375 1:26281909-26281931 GCATGGGTCTAGTGGCAAAATGG + Intronic
904042169 1:27591296-27591318 GGCTGGGTGTGGTGCCAGAGCGG - Intronic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
906208147 1:43997817-43997839 GGCTGGGTAGCCAGGCAAAATGG - Intronic
906402639 1:45516720-45516742 GGCTGGGTGTGGTGGCATGGTGG + Intronic
906504296 1:46366569-46366591 GGCTGGGCATGGTGGCATGGTGG + Intergenic
906901810 1:49843893-49843915 GGCTGGGTAGCAGGGCAAAAAGG + Intronic
907946614 1:59141430-59141452 GGCTGGGTCTGTTGGCAGAAAGG - Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908495256 1:64688507-64688529 GGCTGGATTTGGTGACCAAATGG - Intronic
908606046 1:65797931-65797953 GACTGAGAATGGTGGCAAGAGGG - Intronic
910984381 1:92991458-92991480 GGCTGAGTGTGGTGCCAAAGTGG + Intergenic
911685076 1:100766105-100766127 GGCTGTGTATAGAGCCAAAATGG + Intergenic
912434017 1:109645667-109645689 GGCTGGGCATGGTGGCACCGTGG + Intergenic
912525216 1:110277849-110277871 GGCTGGGCATGGTGGCTCATAGG + Intronic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
915070530 1:153261835-153261857 TGCTGGGTCTGGTGGCAGATCGG - Exonic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
918560342 1:185858562-185858584 AGCTGGGTGTGGTGGCATATAGG - Intronic
920096531 1:203490009-203490031 GGCTGGGCATGGTGGCTCAATGG - Exonic
920833545 1:209487002-209487024 GGCTGGGGATGGTGGTGACAGGG - Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
922238232 1:223737280-223737302 GGCTGGGTATGGAGGCAGCCTGG + Intronic
922600306 1:226846274-226846296 GGCTGGGCATGGTGGCAGGTGGG + Intergenic
923785601 1:237065614-237065636 GGCTAGGGATGGTGGCACTAAGG - Intronic
923970657 1:239199874-239199896 GGCTGGGCATGGTGGCTCTAAGG + Intergenic
924307397 1:242704425-242704447 GGCTGGGTGTGGTGGCCTAAAGG + Intergenic
1063923899 10:10958576-10958598 GGCTGGGCATGGTGGCTCAGAGG + Intergenic
1068403862 10:56564560-56564582 GTATGGGTTTGGTGGTAAAAAGG + Intergenic
1069245070 10:66194298-66194320 GGCTGGGTGTGGTGGCTTACAGG + Intronic
1069816763 10:71201380-71201402 GGATGGGTATGCTGGACAAATGG - Intergenic
1070815808 10:79322541-79322563 GGCTGGGGATGGTGGCAGATGGG - Intergenic
1071366822 10:84908365-84908387 GGCAGGGGAAGGTGGCAATATGG + Intergenic
1071687750 10:87779034-87779056 GGCTGGGCATGGTGGCACTTTGG + Intronic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072477921 10:95781266-95781288 GGCTGGGTAGAATGGAAAAAGGG + Intronic
1072755149 10:98015338-98015360 GGCTGGGTATAGGGGGAAATGGG + Intronic
1073234778 10:102004788-102004810 GGCTGGGCATGGTGGCTCATGGG + Intronic
1074859461 10:117499397-117499419 GGCTTGGTATTGTGGCAACCTGG + Intergenic
1074918947 10:117987774-117987796 GGCTGGGGAGGGTAGCAACAGGG - Intergenic
1075313610 10:121434405-121434427 GGCTGGGAAGTGTGGCAGAAGGG - Intergenic
1078491802 11:11776344-11776366 TGTTTGGTATGGTGGCAAATAGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1083946262 11:65924734-65924756 GGCTGGGGAAGGAGGCAGAAGGG + Intergenic
1084135905 11:67181416-67181438 GGCTGGATGTAGTTGCAAAATGG + Intronic
1085620555 11:78034932-78034954 GGCTACATATGGTGGCAAGATGG - Intronic
1086157146 11:83679924-83679946 GGGTAGGGAAGGTGGCAAAAAGG - Intronic
1086190759 11:84075981-84076003 GCCTGAGGATGGTGGCATAAAGG + Intronic
1088720232 11:112585663-112585685 GGCTGGGTGGGGTGGCAGAGAGG + Intergenic
1089732124 11:120525647-120525669 GGCTGGGGATGGGGGCAGAGTGG + Intronic
1090363327 11:126187804-126187826 GGCTGGGTAGGGTGGCAGGGTGG + Intergenic
1091437119 12:481497-481519 GGCTGGCCATGGTGGGAAAGTGG + Intronic
1091844102 12:3641996-3642018 GGTAGGGGATGATGGCAAAAGGG - Intronic
1093127700 12:15350248-15350270 GACTGGGGGTGCTGGCAAAATGG + Intronic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1094149806 12:27270348-27270370 AGCTGGGTGTGGTGGCACACTGG - Intronic
1094239953 12:28211248-28211270 GGCTTGGCATGTTGGCAAAGGGG - Intronic
1094365861 12:29680420-29680442 GGCTGGGTGTGGTGGCTCAGAGG + Intronic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095632614 12:44396245-44396267 TGCTGGTTATGGTGGAAAAGCGG - Intergenic
1096332412 12:50725806-50725828 GGCTGGGAATGGAGCCAAACTGG - Intronic
1097607877 12:61778308-61778330 GGGTGGGGATGGTAGCAGAATGG - Intronic
1100271322 12:93028039-93028061 GGCTGGGCATGTTGGCGGAAAGG + Intergenic
1100291500 12:93219041-93219063 GGCTGGGCATGGTGGCTTACTGG - Intergenic
1100864428 12:98841659-98841681 AGCTACGTATGGAGGCAAAAAGG + Intronic
1101423204 12:104566006-104566028 GCCTAGGAATGGAGGCAAAAGGG - Intronic
1102919641 12:116782229-116782251 GGCTGTGTGTGGTGGCTCAATGG + Intronic
1103630214 12:122253957-122253979 GGCTGGGTGTGGTGGCACTTTGG - Intronic
1103640218 12:122345299-122345321 AGCTGGGTGTGGTGGCTACATGG - Intronic
1104229594 12:126871667-126871689 GGCTGGGCATGGTGGCACTTTGG + Intergenic
1105766271 13:23562669-23562691 AGCTGAGTATGGTGCCAAATAGG + Intergenic
1109420697 13:62107221-62107243 GGTTGGCTAGGGTGGCGAAATGG - Intergenic
1110983926 13:81939437-81939459 GGCTGGGTATGCTGGGGAACTGG + Intergenic
1112375595 13:98837248-98837270 GCTTGGGTATGGTGGAAACACGG - Intronic
1114538961 14:23440815-23440837 GGATGGGAATAATGGCAAAAGGG + Intergenic
1115309030 14:31961064-31961086 AGCTGGGCATGGTGGCATGATGG - Intergenic
1115481971 14:33869262-33869284 AGCCTGGTATGCTGGCAAAAGGG + Intergenic
1116626152 14:47266464-47266486 GGCAGGGAATAGTGGCAAGATGG - Intronic
1116788103 14:49309960-49309982 GGCAGGGTTTGGTGGAATAAAGG + Intergenic
1117909502 14:60623427-60623449 GGCTGGGTATGATAGCATAAAGG + Intergenic
1118641737 14:67798878-67798900 GGCGGGGCCTGGTGGCCAAAAGG - Intronic
1118734267 14:68690792-68690814 GGCTGGGTGTGGGGGCACAGGGG - Intronic
1119444789 14:74654145-74654167 GGCTTGGCATGGTGGGAAGAAGG - Intronic
1119811540 14:77524842-77524864 GGCTGGGAATGGTAGGGAAAGGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121330391 14:93046052-93046074 GGGTGGGGATGGGGTCAAAAAGG - Intronic
1121803090 14:96791760-96791782 GGCAGGGTGAGGTGGCAACATGG - Intergenic
1123437404 15:20264862-20264884 AGCTGGGCATGGTGGTTAAAAGG + Intergenic
1123899475 15:24862356-24862378 GGGTGGGGAGGCTGGCAAAAAGG + Intronic
1126435696 15:48635213-48635235 GGCTGGGAATGGTGGAGATAGGG + Intronic
1126775517 15:52096915-52096937 AGCTGGGTATGGTGGCACGCAGG + Intergenic
1127178997 15:56395103-56395125 GTCAGGGTGTGGTGGCTAAAGGG - Intronic
1127659677 15:61088676-61088698 GGCTGGGTCTGAGAGCAAAATGG + Intronic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1128222588 15:65979655-65979677 GGCAGGGTATGTTGGCTAAAAGG + Intronic
1129573496 15:76715574-76715596 GGCTGGGTCCAGTGGCAACAAGG - Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130066741 15:80611146-80611168 GGCTGTGTAAGGTGTTAAAAAGG - Intergenic
1133823439 16:9257082-9257104 GGCTTGGCATGGTGGCAGCAGGG + Intergenic
1133908608 16:10044176-10044198 AGCTGGGCATGGTGGCGAGACGG - Intronic
1134687430 16:16168616-16168638 GGGTGGGTGTGGTTGCAAAAGGG + Intronic
1135629828 16:24027416-24027438 GGCTGGTTAAGCTGCCAAAAGGG + Intronic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136168444 16:28472270-28472292 AGCTGGGTGTGGTGGCTAATTGG + Intergenic
1136168769 16:28474820-28474842 GGCTGGGTGTGGTGGCTCATGGG + Intergenic
1136223696 16:28844919-28844941 GCCTGGGTAAGGATGCAAAAGGG - Intronic
1136351652 16:29712640-29712662 AGCCTGGTATGCTGGCAAAAGGG + Intergenic
1136847170 16:33585959-33585981 AGCTGGGCATGGTGGTTAAAAGG - Intergenic
1139511248 16:67429824-67429846 GGCTGTGTCTGGTGGCAGAGAGG + Intergenic
1139809990 16:69606573-69606595 GGCTGGGTATGGTGGCTCACGGG + Intronic
1140421003 16:74818753-74818775 GGCTGGGAAGGGTGGGGAAAGGG - Intergenic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1140988443 16:80183572-80183594 GCCTGGGACTGGGGGCAAAAGGG + Intergenic
1141933532 16:87220833-87220855 GGCTGGGCATGGTGGCTCATGGG + Intronic
1203108878 16_KI270728v1_random:1434614-1434636 AGCTGGGCATGGTGGTTAAAAGG - Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142698615 17:1646684-1646706 GGCAGGGGATGGTGAGAAAAGGG + Intronic
1144088664 17:11833725-11833747 GGCTGGTTATTGTAGAAAAAGGG + Intronic
1146362110 17:32185549-32185571 AGCTGGGTATGGTGGCACACAGG - Intronic
1146803390 17:35845009-35845031 AGGTGGCTATGGAGGCAAAATGG + Exonic
1147999546 17:44379838-44379860 GGATGTGTATGGTAGCAAGATGG - Intronic
1149654237 17:58301908-58301930 GACTGGGAAGGGTGGCAGAAGGG + Intronic
1149905007 17:60518237-60518259 GCCTGGGTAACATGGCAAAATGG - Intronic
1150387113 17:64770914-64770936 AGCTGGGCATGGTGGCACACAGG + Intergenic
1153284302 18:3444088-3444110 AGCTGGGCATGGTGGCACAGTGG - Intronic
1155139683 18:23033174-23033196 GGCCGGGTGTGGTGGCTCAAAGG - Intergenic
1155414352 18:25581426-25581448 GGTTGGGTGTAGTGGCAACAAGG + Intergenic
1155820481 18:30369258-30369280 AGCTGGGCATGGTGGCACACTGG + Intergenic
1156416987 18:36905681-36905703 GGCTGTATCTGGAGGCAAAAAGG - Intronic
1156511539 18:37641034-37641056 GTCTGGGTTTGGTGTCTAAAAGG + Intergenic
1157051548 18:44172005-44172027 GGCTTGTTTTGATGGCAAAATGG - Intergenic
1159332946 18:67024868-67024890 AGCTGGGTGTGGTGGCAGATTGG + Intergenic
1160762603 19:793020-793042 GGCTGGGTGTGGTGGCTCACAGG + Intergenic
1161237681 19:3206040-3206062 GGCTGGGTCTGGCGGCACAGAGG - Intronic
1162215961 19:9134188-9134210 GGCTGGGCATGGTGGCGAAACGG - Intergenic
1163251226 19:16127525-16127547 AGGTGGGCATGGTGGCACAAGGG + Exonic
1163502792 19:17686644-17686666 GGCTGGGGGTGGTGGAAGAAGGG - Intronic
1163506163 19:17707624-17707646 GGCTGGCTATGGGGGGCAAATGG - Intergenic
1163633425 19:18428080-18428102 GGCTGGGGATGGTGGCAGTTTGG + Intronic
1164883179 19:31753423-31753445 GGCTGGGGAAGGTGGGAATAGGG + Intergenic
1165033396 19:33014786-33014808 AGCTGGGCATGGTGGTTAAAAGG + Intronic
1165900505 19:39167270-39167292 GGCTGGGCATGGGGCCAAAGGGG + Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
1166366662 19:42281431-42281453 GCCTGGGTGTGGTGGCACAGTGG + Intronic
1166537660 19:43585142-43585164 GGCTGAGCATGGTGGCATATGGG - Exonic
1167394399 19:49218595-49218617 GGCTGGGTGTGGTGGCTCACAGG - Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
924973984 2:156535-156557 AGCTGGGTATAGAGGAAAAACGG + Intergenic
927887966 2:26730149-26730171 GGCTGGGTCTCATGGCAGAAAGG + Exonic
929170296 2:38925865-38925887 GCCTGGGTAATGTGGCAAAAAGG + Intronic
933027570 2:77280183-77280205 GGCTGGCTTTGGAGGTAAAATGG + Intronic
933259763 2:80119159-80119181 GGCTTGTCATGGTGGCAAGATGG + Intronic
933688718 2:85162888-85162910 AGCGGGGAATGGTGGGAAAAAGG - Intronic
933707550 2:85303302-85303324 GGTTGGGCATGGTGGCACACCGG - Intronic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936584399 2:113741271-113741293 GGCTGGGGGTGGTGGGAAAGAGG + Intronic
936773452 2:115942979-115943001 GGCTGGGAATGCTTGCCAAATGG + Intergenic
937018925 2:118633052-118633074 GGCGGGGCGTGGTGGCAAGAAGG - Intergenic
937954328 2:127412020-127412042 GGTTGGGCATGGTGGAAGAAGGG - Intergenic
938599003 2:132818239-132818261 GGCTGGGTATGGTGTCACACCGG - Intronic
939878809 2:147606876-147606898 GGCGGGGTGTGGGGGCACAATGG + Intergenic
941974316 2:171386617-171386639 AGCTGGGCGTGGTGGCAATATGG + Intronic
943777951 2:191787835-191787857 AGCTGGATGTGGTGGCAAACAGG - Intergenic
944115770 2:196184671-196184693 GGCTGGGTGCGGTGGCTCAATGG + Intergenic
944656981 2:201885346-201885368 GGCTGGGGATGTTGGAAAAGAGG + Intronic
946096798 2:217281489-217281511 GGCTGGGTGTGGTGGGAGACCGG - Intergenic
946306064 2:218857694-218857716 GGCTGGGTCTGGAGGCAGCAGGG + Intergenic
947966948 2:234289842-234289864 GGCTGGGTATGTGGTGAAAATGG - Intergenic
948755468 2:240157242-240157264 GGCTGGGGATGGTGACATGAAGG + Intergenic
1168887390 20:1268963-1268985 GGGTGGTGATGTTGGCAAAAAGG + Intronic
1170222271 20:13953132-13953154 AGCTTGATATGCTGGCAAAAGGG + Intronic
1173609173 20:44354292-44354314 AGCCGGGCATGGTGGCAAACGGG - Intergenic
1174138649 20:48397931-48397953 AGCTGAGGATGGTGGCAGAAAGG + Intergenic
1174571875 20:51507953-51507975 TGCTGGGCAGGGTGGCATAATGG - Intronic
1176003903 20:62848887-62848909 AGCTGGGTGTGGTGGCTCAATGG + Intronic
1178855117 21:36244307-36244329 GGCTGGGTGTGGTGGCATGGTGG - Intronic
1179085594 21:38214880-38214902 GTCTGGATCAGGTGGCAAAATGG - Intronic
1179797883 21:43796020-43796042 GGCTGGTTATGGTGGGTTAAGGG + Intronic
1180702019 22:17786400-17786422 AGCTGGGTGTGGTGGCACACTGG - Intergenic
1181063720 22:20295199-20295221 GGCTGGGAAGGGTGGAAAGAAGG - Intergenic
1181859035 22:25804233-25804255 GGCTGGGTTTTGTGTGAAAAGGG - Intronic
1183491475 22:38118897-38118919 AGCTGGGCATGGTGGCACTATGG - Intronic
949129919 3:487473-487495 GGCTGAGGAAGGTGGCTAAAAGG + Intergenic
949467304 3:4357087-4357109 GGCTGGCTATGGAGGAACAAAGG - Intronic
953675093 3:44994834-44994856 TGCTGGCTATGGTGGAAGAATGG + Intronic
954220710 3:49151952-49151974 GTCTGCCTATGGTGGGAAAAGGG + Intergenic
955135059 3:56209112-56209134 GGCTGGGCAGAGTGGCAAAAAGG - Intronic
956002508 3:64744489-64744511 GGCAGGGTCTGGTGCCAAGAAGG + Intergenic
957604343 3:82378148-82378170 AGCTTGGCATGCTGGCAAAAGGG - Intergenic
957823639 3:85411970-85411992 AGCTGGGCATGGTGGCATATGGG - Intronic
958068428 3:88576527-88576549 GTCTGGGTATTGTGGAACAATGG + Intergenic
959271045 3:104210531-104210553 GGCTGGGCACGGTGGCTAACAGG - Intergenic
960281523 3:115785704-115785726 AGCTTGTTATGGTGGCAAAAAGG + Intergenic
960878278 3:122318339-122318361 TGGTGGATATGGTGGCAATAAGG + Intergenic
961184333 3:124901545-124901567 GGGTAGGTTTGGGGGCAAAATGG + Intergenic
961517048 3:127444499-127444521 AGCTGGGTGTGGTGGCAGCATGG - Intergenic
962306554 3:134292033-134292055 GGCCTGGGATGGTGGCCAAATGG + Intergenic
962915177 3:139894716-139894738 GGTTGGGTATGGTGGGAGACAGG + Intergenic
962991102 3:140578183-140578205 GGCTGGGGAGGCTGGCCAAAAGG - Intergenic
964915716 3:161838784-161838806 GGCAGAGTATGGAGCCAAAAAGG + Intergenic
967150727 3:186647003-186647025 GGCTTGGTAAGGTGGCAATGGGG - Intronic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
967974479 3:195025324-195025346 GGCTGGGTGTGAAGGCAAACTGG - Intergenic
968474735 4:798534-798556 AGCTGGGCATGGTGGCACATGGG - Intronic
970578338 4:17449499-17449521 GGCTAGGAATAGTGGGAAAATGG + Intergenic
973612952 4:52654671-52654693 GGCTGGGCATGGTGGCTCACTGG - Intronic
973857495 4:55027868-55027890 GGCTGGGTATGATTACAAAGGGG + Intergenic
974158442 4:58104313-58104335 GGCTGGGCACGGTGGCTTAAGGG + Intergenic
974730917 4:65864773-65864795 GGCTTGGTAGGCTGGGAAAAAGG + Intergenic
975562856 4:75724154-75724176 GGCTTTGTTTGGTGGTAAAAAGG - Intronic
975732645 4:77352914-77352936 GGCTGTGGGTGGTGGAAAAATGG + Intronic
979274801 4:118803081-118803103 GGCTGGGTGGGGTGGAAGAATGG + Intronic
981200997 4:141979253-141979275 GGCCTGGCATGCTGGCAAAAGGG + Intergenic
983909635 4:173223267-173223289 GGCAGGATATGGTGTGAAAAAGG - Intronic
984789479 4:183602206-183602228 AGCTGGGCATGGTGGCAACTTGG + Intergenic
986004329 5:3655601-3655623 GGCTGGTGATGGGGGCAAGAGGG - Intergenic
989048780 5:37297657-37297679 GGCTGGGCATGGTGGCTCACAGG - Intronic
989559215 5:42831896-42831918 GGCTGGGTATGTTCGAAAACAGG - Intronic
990045539 5:51426105-51426127 GGCTGGGTATGTGAGCTAAAGGG - Intergenic
990245693 5:53861358-53861380 GGATGGGAAGGGTGGTAAAATGG - Intergenic
991607544 5:68418824-68418846 GGCAGGGTAACGTGGCAACATGG - Intergenic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
997457725 5:134029749-134029771 GGTTAGGGATGGTGGGAAAAGGG + Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
997925840 5:138030744-138030766 GGCTGGGCAAGGTGGCAAGGTGG + Intronic
998873644 5:146577133-146577155 GGCTTCATATGGTGGCAAGATGG + Intergenic
999317507 5:150593847-150593869 GTCTGGGTTTGGTGGGTAAATGG + Intergenic
999390244 5:151184284-151184306 AGCTGGGAATTTTGGCAAAAAGG + Intronic
999733371 5:154493060-154493082 GGATGTGTATGTTGCCAAAATGG + Intergenic
1001586217 5:172834984-172835006 CGCTGGGTATGGGGGCACCATGG + Intronic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1002060747 5:176624378-176624400 GGCTGGTTATGGTGCCACATTGG + Intronic
1002173221 5:177386615-177386637 AGCTGGGAAGGGTGGCAAATGGG + Intronic
1002220539 5:177676662-177676684 GGATGGGGGAGGTGGCAAAAGGG - Intergenic
1003280941 6:4690802-4690824 GGCTGGGTATCCTGGGGAAATGG - Intergenic
1003313274 6:4987476-4987498 GGCTGGGGTTGGGGGCATAAAGG + Intergenic
1003499715 6:6694459-6694481 GGCTTGAGCTGGTGGCAAAACGG + Intergenic
1005836227 6:29711444-29711466 GGCTGGGTGTGATGGCAGGAAGG + Intergenic
1006379055 6:33687360-33687382 GGCGGGGTATGGTGGCCAGGGGG - Intronic
1006970808 6:38043258-38043280 GGCTGGGCATGGTGGCTCACAGG - Intronic
1007397816 6:41587451-41587473 GGCAGGGTATGGTGGGAGAGGGG - Exonic
1009414017 6:63396165-63396187 GGCTGGGTAGGGTGGAGAGACGG + Intergenic
1014078487 6:117264324-117264346 GGCTGGGTCAGGTGGCGGAAGGG - Intergenic
1015971526 6:138747293-138747315 GGCTGGGAATGGTGGCTCACTGG - Intergenic
1016985008 6:149888538-149888560 ATCTGTGTCTGGTGGCAAAATGG - Exonic
1016995146 6:149956312-149956334 GGCTGGGCATAGTGGCAACCAGG - Intergenic
1017003464 6:150013122-150013144 GGCTGGGCATAGTGGCAACCGGG + Intergenic
1017841659 6:158227273-158227295 GGCTGGGCCTGGGGGCACAAGGG - Intergenic
1018215434 6:161522018-161522040 GGCTGGGAGGGGTGGCAGAACGG + Intronic
1021554641 7:21906719-21906741 GGTTTCTTATGGTGGCAAAATGG - Intronic
1026762994 7:73140474-73140496 GGCTGGGAATGGTGGCAGATGGG + Intergenic
1027039459 7:74950262-74950284 GGCTGGGAATGGTGGCAGATGGG + Intergenic
1027084182 7:75252118-75252140 GGCTGGGAATGGTGGCAGATGGG - Intergenic
1029391753 7:100279897-100279919 GGCTGGGAATAGTGGCAGATGGG - Intergenic
1029460653 7:100692341-100692363 GGCTGGGCAAGTGGGCAAAAGGG - Intergenic
1032124284 7:129181131-129181153 GGCTGGGGAAAGTGGTAAAAGGG - Intergenic
1032374278 7:131394363-131394385 GGCAGGGTATGGTGGAGAGATGG + Intronic
1033661031 7:143402192-143402214 GGCTGGGTGTGGTGGCTCACAGG - Intronic
1034224609 7:149473119-149473141 GGCTGGGTTTGGGGGCCAAGTGG - Exonic
1034684348 7:152956959-152956981 GGCTGGGCATGGTGGCTCACAGG + Intergenic
1034695503 7:153049554-153049576 GGCTGGGCATGGTGGCTCACGGG + Intergenic
1035742942 8:1942925-1942947 GGCTGGGGAAGGGGGCATAAGGG + Intronic
1036940569 8:13048204-13048226 GCCTGAGGATGGTGGCAGAAGGG + Intergenic
1038411259 8:27361559-27361581 GACTGGGCAGGGTGGGAAAATGG + Intronic
1041402191 8:57457536-57457558 GGCTGGAGGTGCTGGCAAAAAGG + Intergenic
1042201669 8:66284806-66284828 GTCTGAGTAAGGTGGCAAATAGG + Intergenic
1043578454 8:81685853-81685875 TGCTGGGACAGGTGGCAAAAAGG - Exonic
1044676545 8:94734305-94734327 GGCTGGGCATGGTGGCACTTTGG - Intronic
1044692313 8:94893850-94893872 GGGTGGGTTTGGGGGAAAAATGG - Intronic
1046697432 8:117357637-117357659 GGCTGGGTTTGGTAGGAGAATGG + Intergenic
1048338882 8:133523755-133523777 GGCTGGGTATGGGAGCCACAAGG + Intronic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1049012674 8:139897786-139897808 GGCTGGTTATGCTGGAAACACGG - Intronic
1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG + Intergenic
1050340147 9:4628705-4628727 GGCTGGGCATGGTGGCACTTTGG - Intronic
1051363329 9:16301646-16301668 GGCTGGGGGTGGTGGGAAAGGGG + Intergenic
1052995783 9:34551071-34551093 GGCTAGGGATGATGGCAGAAGGG - Intergenic
1058983474 9:110191251-110191273 GGCTGGGCATGGTGGCTCACAGG - Intronic
1060536452 9:124392865-124392887 GGCAGGCCATGGTGGCAAACAGG - Intronic
1060587478 9:124795476-124795498 GGCTGGGCATGGTGGCTCAGTGG + Intronic
1061150331 9:128824518-128824540 GGTTGGGAATGGAGGCAAAAGGG - Intronic
1186062935 X:5730307-5730329 AGCTGGGAATGGTGACAAAAAGG + Intergenic
1186248131 X:7636694-7636716 GGCTGGATGTGGTGGCAACTTGG + Intergenic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1187154365 X:16710072-16710094 GGCTGGCTTTGGGGGGAAAAGGG - Intronic
1188215993 X:27477702-27477724 TGCAGGGTTTGATGGCAAAATGG - Intergenic
1188862846 X:35277633-35277655 GGCTGTGAATGGTAGGAAAATGG - Intergenic
1189415311 X:40807525-40807547 GGCTGGGAATGGTGGGAGAAAGG - Intergenic
1192750621 X:73986803-73986825 GGCTGGGCATGGTGGCTCACAGG + Intergenic
1193470342 X:81893527-81893549 GGTTGAGTATGGTGGAAAAAGGG + Intergenic
1193587057 X:83336844-83336866 GGCTGAGGATGATGGTAAAATGG - Intergenic
1195017917 X:100796885-100796907 GACTGGGGATGGTGGCACAATGG - Intergenic
1196261515 X:113587551-113587573 GGCTGCTTGTGTTGGCAAAAAGG - Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196854932 X:119973851-119973873 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1196857337 X:119996581-119996603 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1197240503 X:124118341-124118363 GGCTGGGTGTGGTGGCTCGACGG + Intronic
1197709808 X:129657518-129657540 GGCTAGGTAGGGTGGGAAAATGG - Intergenic
1199660259 X:150042367-150042389 GGCTGGGAAGGGTAGTAAAAGGG - Intergenic
1199869569 X:151886013-151886035 GGCTGGGTATGGATTTAAAAAGG + Intergenic