ID: 921445438

View in Genome Browser
Species Human (GRCh38)
Location 1:215241793-215241815
Sequence CCTAATATGTAAAATGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921445434_921445438 22 Left 921445434 1:215241748-215241770 CCCTAAGTAAGGTTTTTGTTTGT No data
Right 921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG No data
921445433_921445438 27 Left 921445433 1:215241743-215241765 CCACACCCTAAGTAAGGTTTTTG No data
Right 921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG No data
921445435_921445438 21 Left 921445435 1:215241749-215241771 CCTAAGTAAGGTTTTTGTTTGTC No data
Right 921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921445438 Original CRISPR CCTAATATGTAAAATGACGA TGG Intergenic
No off target data available for this crispr