ID: 921446706

View in Genome Browser
Species Human (GRCh38)
Location 1:215255348-215255370
Sequence CAACCTCAGCCGAACTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921446702_921446706 8 Left 921446702 1:215255317-215255339 CCTGCCCTACGTCAGGAAGGAGC No data
Right 921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG No data
921446699_921446706 15 Left 921446699 1:215255310-215255332 CCTTAATCCTGCCCTACGTCAGG No data
Right 921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG No data
921446703_921446706 4 Left 921446703 1:215255321-215255343 CCCTACGTCAGGAAGGAGCCTAA No data
Right 921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG No data
921446698_921446706 21 Left 921446698 1:215255304-215255326 CCACTTCCTTAATCCTGCCCTAC No data
Right 921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG No data
921446704_921446706 3 Left 921446704 1:215255322-215255344 CCTACGTCAGGAAGGAGCCTAAA No data
Right 921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921446706 Original CRISPR CAACCTCAGCCGAACTTCTC AGG Intergenic
No off target data available for this crispr