ID: 921453880

View in Genome Browser
Species Human (GRCh38)
Location 1:215343272-215343294
Sequence ATGTAGTAACTTAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921453876_921453880 4 Left 921453876 1:215343245-215343267 CCTCTTGCTAGTGACATCCAGTC No data
Right 921453880 1:215343272-215343294 ATGTAGTAACTTAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921453880 Original CRISPR ATGTAGTAACTTAAGGATGA AGG Intergenic
No off target data available for this crispr