ID: 921456465

View in Genome Browser
Species Human (GRCh38)
Location 1:215377905-215377927
Sequence TCATCCTCTCTACTCCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456465_921456466 1 Left 921456465 1:215377905-215377927 CCATTTAGGAGTAGAGAGGATGA No data
Right 921456466 1:215377929-215377951 TGTGATGAAGCCAGTAATTCAGG No data
921456465_921456468 25 Left 921456465 1:215377905-215377927 CCATTTAGGAGTAGAGAGGATGA No data
Right 921456468 1:215377953-215377975 CTTAATTCCTTCTCGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456465 Original CRISPR TCATCCTCTCTACTCCTAAA TGG (reversed) Intergenic