ID: 921456467

View in Genome Browser
Species Human (GRCh38)
Location 1:215377939-215377961
Sequence GGAATTAAGTCCTGAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456467_921456473 30 Left 921456467 1:215377939-215377961 CCAGTAATTCAGGACTTAATTCC No data
Right 921456473 1:215377992-215378014 CAGAATATGAAATAGCTTCCAGG No data
921456467_921456468 -9 Left 921456467 1:215377939-215377961 CCAGTAATTCAGGACTTAATTCC No data
Right 921456468 1:215377953-215377975 CTTAATTCCTTCTCGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456467 Original CRISPR GGAATTAAGTCCTGAATTAC TGG (reversed) Intergenic
No off target data available for this crispr