ID: 921456468

View in Genome Browser
Species Human (GRCh38)
Location 1:215377953-215377975
Sequence CTTAATTCCTTCTCGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456465_921456468 25 Left 921456465 1:215377905-215377927 CCATTTAGGAGTAGAGAGGATGA No data
Right 921456468 1:215377953-215377975 CTTAATTCCTTCTCGTGTTGTGG No data
921456467_921456468 -9 Left 921456467 1:215377939-215377961 CCAGTAATTCAGGACTTAATTCC No data
Right 921456468 1:215377953-215377975 CTTAATTCCTTCTCGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456468 Original CRISPR CTTAATTCCTTCTCGTGTTG TGG Intergenic
No off target data available for this crispr