ID: 921456468 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:215377953-215377975 |
Sequence | CTTAATTCCTTCTCGTGTTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921456465_921456468 | 25 | Left | 921456465 | 1:215377905-215377927 | CCATTTAGGAGTAGAGAGGATGA | No data | ||
Right | 921456468 | 1:215377953-215377975 | CTTAATTCCTTCTCGTGTTGTGG | No data | ||||
921456467_921456468 | -9 | Left | 921456467 | 1:215377939-215377961 | CCAGTAATTCAGGACTTAATTCC | No data | ||
Right | 921456468 | 1:215377953-215377975 | CTTAATTCCTTCTCGTGTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921456468 | Original CRISPR | CTTAATTCCTTCTCGTGTTG TGG | Intergenic | ||