ID: 921456469

View in Genome Browser
Species Human (GRCh38)
Location 1:215377960-215377982
Sequence CAAAAAACCACAACACGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456469_921456473 9 Left 921456469 1:215377960-215377982 CCTTCTCGTGTTGTGGTTTTTTG No data
Right 921456473 1:215377992-215378014 CAGAATATGAAATAGCTTCCAGG No data
921456469_921456475 29 Left 921456469 1:215377960-215377982 CCTTCTCGTGTTGTGGTTTTTTG No data
Right 921456475 1:215378012-215378034 AGGAGCTCCAGCTATAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456469 Original CRISPR CAAAAAACCACAACACGAGA AGG (reversed) Intergenic