ID: 921456472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:215377991-215378013 |
| Sequence | CTGGAAGCTATTTCATATTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921456472_921456477 | 26 | Left | 921456472 | 1:215377991-215378013 | CCAGAATATGAAATAGCTTCCAG | No data | ||
| Right | 921456477 | 1:215378040-215378062 | TCTGTGTGATTTTAATCACATGG | No data | ||||
| 921456472_921456475 | -2 | Left | 921456472 | 1:215377991-215378013 | CCAGAATATGAAATAGCTTCCAG | No data | ||
| Right | 921456475 | 1:215378012-215378034 | AGGAGCTCCAGCTATAAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921456472 | Original CRISPR | CTGGAAGCTATTTCATATTC TGG (reversed) | Intergenic | ||