ID: 921456473

View in Genome Browser
Species Human (GRCh38)
Location 1:215377992-215378014
Sequence CAGAATATGAAATAGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456469_921456473 9 Left 921456469 1:215377960-215377982 CCTTCTCGTGTTGTGGTTTTTTG No data
Right 921456473 1:215377992-215378014 CAGAATATGAAATAGCTTCCAGG No data
921456467_921456473 30 Left 921456467 1:215377939-215377961 CCAGTAATTCAGGACTTAATTCC No data
Right 921456473 1:215377992-215378014 CAGAATATGAAATAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456473 Original CRISPR CAGAATATGAAATAGCTTCC AGG Intergenic
No off target data available for this crispr