ID: 921456475

View in Genome Browser
Species Human (GRCh38)
Location 1:215378012-215378034
Sequence AGGAGCTCCAGCTATAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921456472_921456475 -2 Left 921456472 1:215377991-215378013 CCAGAATATGAAATAGCTTCCAG No data
Right 921456475 1:215378012-215378034 AGGAGCTCCAGCTATAAGCTTGG No data
921456470_921456475 6 Left 921456470 1:215377983-215378005 CCCTTGCACCAGAATATGAAATA No data
Right 921456475 1:215378012-215378034 AGGAGCTCCAGCTATAAGCTTGG No data
921456471_921456475 5 Left 921456471 1:215377984-215378006 CCTTGCACCAGAATATGAAATAG No data
Right 921456475 1:215378012-215378034 AGGAGCTCCAGCTATAAGCTTGG No data
921456469_921456475 29 Left 921456469 1:215377960-215377982 CCTTCTCGTGTTGTGGTTTTTTG No data
Right 921456475 1:215378012-215378034 AGGAGCTCCAGCTATAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921456475 Original CRISPR AGGAGCTCCAGCTATAAGCT TGG Intergenic