ID: 921457384

View in Genome Browser
Species Human (GRCh38)
Location 1:215388829-215388851
Sequence CATCTTAACCACAGTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921457376_921457384 24 Left 921457376 1:215388782-215388804 CCTCGGGAAACTGACAATCATGG 0: 2
1: 198
2: 6168
3: 8578
4: 6715
Right 921457384 1:215388829-215388851 CATCTTAACCACAGTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921457384 Original CRISPR CATCTTAACCACAGTGACTC AGG Intergenic
No off target data available for this crispr