ID: 921457384 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:215388829-215388851 |
| Sequence | CATCTTAACCACAGTGACTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921457376_921457384 | 24 | Left | 921457376 | 1:215388782-215388804 | CCTCGGGAAACTGACAATCATGG | 0: 2 1: 198 2: 6168 3: 8578 4: 6715 |
||
| Right | 921457384 | 1:215388829-215388851 | CATCTTAACCACAGTGACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921457384 | Original CRISPR | CATCTTAACCACAGTGACTC AGG | Intergenic | ||
| No off target data available for this crispr | |||||