ID: 921460602

View in Genome Browser
Species Human (GRCh38)
Location 1:215421685-215421707
Sequence TATTACAGTTAGAAAGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921460602_921460609 -3 Left 921460602 1:215421685-215421707 CCCCCAACTTTCTAACTGTAATA No data
Right 921460609 1:215421705-215421727 ATAGAGGGTGGCTGCTTTGTTGG No data
921460602_921460610 1 Left 921460602 1:215421685-215421707 CCCCCAACTTTCTAACTGTAATA No data
Right 921460610 1:215421709-215421731 AGGGTGGCTGCTTTGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921460602 Original CRISPR TATTACAGTTAGAAAGTTGG GGG (reversed) Intergenic
No off target data available for this crispr