ID: 921463830

View in Genome Browser
Species Human (GRCh38)
Location 1:215461658-215461680
Sequence ACATATCCCCTGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921463830_921463834 2 Left 921463830 1:215461658-215461680 CCCTCCTCCATCAGGGGATATGT No data
Right 921463834 1:215461683-215461705 TCAGTTTGAATAACTGAGCCAGG No data
921463830_921463836 29 Left 921463830 1:215461658-215461680 CCCTCCTCCATCAGGGGATATGT No data
Right 921463836 1:215461710-215461732 TCTCTTTAGCATCCAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921463830 Original CRISPR ACATATCCCCTGATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr