ID: 921464144

View in Genome Browser
Species Human (GRCh38)
Location 1:215465105-215465127
Sequence TTCTAGTTATTCATCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921464144_921464149 16 Left 921464144 1:215465105-215465127 CCCACCATGATGAATAACTAGAA No data
Right 921464149 1:215465144-215465166 CATGTAGACACCTGAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921464144 Original CRISPR TTCTAGTTATTCATCATGGT GGG (reversed) Intergenic
No off target data available for this crispr