ID: 921465611

View in Genome Browser
Species Human (GRCh38)
Location 1:215483434-215483456
Sequence CCAGTCTGTTAGGACAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921465611_921465615 15 Left 921465611 1:215483434-215483456 CCTGGTTTGTCCTAACAGACTGG No data
Right 921465615 1:215483472-215483494 TGCCCACCCACATTGAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921465611 Original CRISPR CCAGTCTGTTAGGACAAACC AGG (reversed) Intergenic
No off target data available for this crispr