ID: 921465679

View in Genome Browser
Species Human (GRCh38)
Location 1:215484223-215484245
Sequence TCCTGTCCTGCTCTTTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921465679_921465689 10 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465689 1:215484256-215484278 GGACTTGGGGGTGGTTTCACTGG No data
921465679_921465687 -2 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465687 1:215484244-215484266 GAGGAAGGTCTGGGACTTGGGGG No data
921465679_921465685 -4 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465685 1:215484242-215484264 AGGAGGAAGGTCTGGGACTTGGG No data
921465679_921465684 -5 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465684 1:215484241-215484263 CAGGAGGAAGGTCTGGGACTTGG No data
921465679_921465686 -3 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465686 1:215484243-215484265 GGAGGAAGGTCTGGGACTTGGGG No data
921465679_921465688 1 Left 921465679 1:215484223-215484245 CCAGAACAAAGAGCAGGACAGGA No data
Right 921465688 1:215484247-215484269 GAAGGTCTGGGACTTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921465679 Original CRISPR TCCTGTCCTGCTCTTTGTTC TGG (reversed) Intergenic
No off target data available for this crispr