ID: 921474196

View in Genome Browser
Species Human (GRCh38)
Location 1:215586302-215586324
Sequence GAAGCCACAATATTATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921474196_921474202 27 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 27
4: 262
921474196_921474201 23 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474201 1:215586348-215586370 TTTTATTTGTAATAGGAAGGTGG 0: 1
1: 0
2: 4
3: 78
4: 1957
921474196_921474200 20 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474200 1:215586345-215586367 AAATTTTATTTGTAATAGGAAGG 0: 1
1: 0
2: 6
3: 65
4: 641
921474196_921474203 28 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474203 1:215586353-215586375 TTTGTAATAGGAAGGTGGATGGG 0: 1
1: 0
2: 1
3: 28
4: 214
921474196_921474199 16 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474199 1:215586341-215586363 AACAAAATTTTATTTGTAATAGG 0: 1
1: 0
2: 6
3: 124
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921474196 Original CRISPR GAAGCCACAATATTATCCTT GGG (reversed) Intronic
900667258 1:3823884-3823906 GGAGCCACAATTTCAACCTTGGG - Intronic
904407114 1:30299575-30299597 GAGGCCACAAAACTAGCCTTTGG + Intergenic
905783596 1:40734227-40734249 GAACCCAGAATATTTTCCATGGG + Intronic
906417811 1:45635058-45635080 GAAGACACAATAATAGCTTTAGG + Intronic
907595086 1:55712419-55712441 GAAGCCACAAATCAATCCTTTGG + Intergenic
908115446 1:60935658-60935680 GATGCCATTATATTTTCCTTGGG - Intronic
908633315 1:66134517-66134539 CAAGCCACAATGGTACCCTTTGG - Intronic
909053989 1:70801224-70801246 GTAGCCACAATATAATCTTAAGG - Intergenic
911877386 1:103185364-103185386 GAAGACACAATACAATCATTTGG - Intergenic
913960820 1:143337047-143337069 GAAGCCACCAAAGTCTCCTTGGG + Intergenic
914055174 1:144162619-144162641 GAAGCCACCAAAGTCTCCTTGGG + Intergenic
914123972 1:144803742-144803764 GAAGCCACCAAAGTCTCCTTGGG - Intergenic
914942679 1:152036720-152036742 GAAGCCCTAAAATCATCCTTGGG - Intronic
915827832 1:159097422-159097444 CAACCCAAAATATTATCTTTAGG + Intronic
915962623 1:160279703-160279725 GTAGCCACAATTTTCACCTTAGG + Intronic
916080417 1:161228754-161228776 CAAGACACAACATTCTCCTTTGG + Exonic
916353780 1:163881622-163881644 GAGGCCATAGTATAATCCTTAGG - Intergenic
917496574 1:175545958-175545980 GAAGCCAGAACTTTCTCCTTTGG - Intronic
918944669 1:191047994-191048016 GAATCCATGATATTATTCTTAGG + Intergenic
920982241 1:210848718-210848740 GAAGCCAAAATTTCATGCTTGGG - Intronic
921474196 1:215586302-215586324 GAAGCCACAATATTATCCTTGGG - Intronic
1067029260 10:42869302-42869324 GAAGCCACCAAAGTCTCCTTGGG + Intergenic
1069507678 10:69015933-69015955 GAATCCACAGTATTATCTGTTGG + Exonic
1071355624 10:84790610-84790632 GAACCCACAAAATTATGTTTTGG - Intergenic
1073846691 10:107564153-107564175 AAAGCCTCAAGATTATCCATAGG - Intergenic
1078656177 11:13242398-13242420 GAAGTCACCATAATATCCCTGGG - Intergenic
1083104583 11:60345766-60345788 GAAGCCACCAAATTAACCCTGGG - Intronic
1083834803 11:65259247-65259269 GAAGCCACCATTTTAGCCCTGGG + Intergenic
1087424146 11:97968098-97968120 GAAGCCACCAAATTAACCCTGGG - Intergenic
1093244534 12:16720327-16720349 AAAGCCTCAATCTTTTCCTTAGG + Intergenic
1093841488 12:23907915-23907937 GATTCCAAAATAATATCCTTAGG + Intronic
1094582398 12:31746074-31746096 GGAGACACAAAATTATCTTTAGG + Intergenic
1095084333 12:38045116-38045138 GAATCCACAATGTTATATTTTGG + Intergenic
1098660734 12:73090123-73090145 GAAAACACTATATTATCCCTAGG - Intergenic
1100614686 12:96221931-96221953 GAAGCCAGAATAATTGCCTTGGG - Intronic
1108944421 13:56003151-56003173 GAAGCCACTTTTTTCTCCTTAGG + Intergenic
1111012324 13:82328325-82328347 GAAGCCACCAAATTAACCCTGGG + Intergenic
1111517458 13:89353401-89353423 GAAGGCCCAATTTTCTCCTTTGG + Intergenic
1111576853 13:90165727-90165749 AAAGCTACAATAGTTTCCTTAGG + Intergenic
1112640601 13:101269681-101269703 GAAGCCACACCATTCTGCTTTGG + Intronic
1113365073 13:109668372-109668394 GAAGCTAGAATTTTATACTTGGG + Intergenic
1115530761 14:34324943-34324965 GAGGCCAAAATCTTACCCTTAGG + Intronic
1116659781 14:47694686-47694708 TAAGCAATAATTTTATCCTTTGG - Intergenic
1123826216 15:24084861-24084883 GAGGCAACAATTTTGTCCTTTGG - Intergenic
1125925540 15:43559981-43560003 GAAGCCTCAATTGTATCCTTGGG - Intronic
1125938684 15:43659532-43659554 GAAGCCTCAATTGTATCCTTGGG - Intronic
1127585446 15:60373627-60373649 GCAGCCACAATATAGTGCTTTGG + Intronic
1129094230 15:73185718-73185740 GAAGCAACCAAAATATCCTTTGG + Intronic
1130768872 15:86903933-86903955 GAAGCCACATTATTACCCAGTGG + Intronic
1134361585 16:13535748-13535770 GAAGCCAGAATAATGTTCTTAGG + Intergenic
1203125449 16_KI270728v1_random:1574228-1574250 GAGGCTAATATATTATCCTTTGG - Intergenic
1146588624 17:34107116-34107138 GAAGTCACAAAATAATCCTGAGG - Intronic
1150532803 17:66003009-66003031 GCAGTCACAATATTCTCCTTTGG + Intronic
1150562548 17:66305660-66305682 GAAGCCACTTTGTTATCTTTAGG + Intronic
1156370757 18:36469502-36469524 GTATTCACCATATTATCCTTTGG + Intronic
1156856933 18:41792739-41792761 GAAGACAAAATATTATTCTGTGG - Intergenic
1159830304 18:73269211-73269233 GAAGCCTAAACATCATCCTTAGG - Intergenic
1162006414 19:7783131-7783153 AAATCCAAAATATTGTCCTTGGG + Intergenic
1163983825 19:20926562-20926584 GTAGGCTCAATATTAGCCTTAGG - Intronic
1167128871 19:47571467-47571489 GAGGCCAGAAAACTATCCTTAGG - Intergenic
1167655695 19:50762581-50762603 GAGGCCACAGTATTCTCCTGAGG + Intergenic
1202694656 1_KI270712v1_random:115296-115318 GAAGCCACCAAAGTCTCCTTGGG + Intergenic
929123122 2:38499767-38499789 GAATCCACAATTTTAACCTTGGG + Intergenic
934146325 2:89098310-89098332 GAAGACTCAATATTATCCATTGG + Intergenic
934148061 2:89115800-89115822 GAAGACTCAGTATTATCCATTGG + Intergenic
934221224 2:90084809-90084831 GAAGACTCAGTATTATCCATTGG - Intergenic
934222941 2:90102264-90102286 GAAGACTCAATATTATCCATTGG - Intergenic
934275826 2:91572342-91572364 GAAGCCACCAAAGTCTCCTTGGG + Intergenic
934628340 2:95885029-95885051 GAGGCTAATATATTATCCTTTGG - Intronic
934628587 2:95888778-95888800 GAGGCTAATATATTATCCTTTGG - Intronic
934628711 2:95890651-95890673 GAGGCTAATATATTATCCTTTGG - Intronic
934628983 2:95894386-95894408 GAGGCTAATATATTATCCTTTGG - Intronic
934629117 2:95896253-95896275 GAGGCTAATATATTATCCTTTGG - Intronic
934629393 2:95899998-95900020 GAGGCTAATATATTATCCTTTGG - Intronic
934629532 2:95901869-95901891 GAGGCTAATATATTATCCTTTGG - Intronic
934629808 2:95905614-95905636 GAGGCTAATATATTATCCTTTGG - Intronic
934629947 2:95907485-95907507 GAGGCTAATATATTATCCTTTGG - Intronic
934630213 2:95911231-95911253 GAGGCTAATATATTATCCTTTGG - Intronic
934630351 2:95913098-95913120 GAGGCTAATATATTATCCTTTGG - Intronic
934630630 2:95916832-95916854 GAGTCTAAAATATTATCCTTTGG - Intronic
934630908 2:95920583-95920605 GAGGCTAATATATTATCCTTTGG - Intronic
934803557 2:97194041-97194063 GAGGCTAATATATTATCCTTTGG + Intronic
934803706 2:97195909-97195931 GAGGCTAATATATTATCCTTTGG + Intronic
934803988 2:97199649-97199671 GAGGCTAATATATTATCCTTCGG + Intronic
934804120 2:97201517-97201539 GAGGCTAATATATTATCCTTTGG + Intronic
934804402 2:97205255-97205277 GAGGCTAATATATTATCCTTTGG + Intronic
934804675 2:97208997-97209019 GAGGCTAATATATTATCCTTTGG + Intronic
934804806 2:97210862-97210884 GAGGCTAATATATTATCCTTTGG + Intronic
934804941 2:97212737-97212759 GAGGCTAATATATTATCCTTTGG + Intronic
934805184 2:97216494-97216516 GAGGCTAATATATTATCCTTTGG + Intronic
934832300 2:97540892-97540914 GAGGCTAATATATTATCCTTTGG - Intronic
934832541 2:97544645-97544667 GAGGCTAATATATTATCCTTTGG - Intronic
934832663 2:97546523-97546545 GAGGCTAATATATTATCCTTTGG - Intronic
934832799 2:97548393-97548415 GAGGCTAATATATTATCCTTTGG - Intronic
934832931 2:97550277-97550299 GAGGCTAATATATTATCCTTTGG - Intronic
934833061 2:97552143-97552165 GAGGCTAGTATATTATCCTTTGG - Intronic
935289098 2:101594237-101594259 GAAGCAACAATATTGACATTAGG - Intergenic
935550533 2:104448614-104448636 GACGCCACAAAATCATCCTGTGG - Intergenic
937661925 2:124440082-124440104 GAAGCCACAAGATTTACCTAAGG - Intronic
938198034 2:129348970-129348992 GAAGCCACCAAAGTGTCCTTTGG - Intergenic
939560413 2:143725040-143725062 GACACCACATTGTTATCCTTTGG - Intronic
939883679 2:147658173-147658195 GGAGCCCCAATATTAGCCTTAGG - Intergenic
940969577 2:159881018-159881040 GAAGTCTTAATATTATCATTAGG + Intronic
942275601 2:174320805-174320827 CAAGTCAAAATATTATACTTAGG + Intergenic
944874847 2:203951947-203951969 GAAGGAACAATATTATCCAGAGG - Intronic
944944182 2:204664082-204664104 CAAGCCACAGTATTAGCCTCAGG - Intronic
946347918 2:219125961-219125983 GCTGCCAAAATATTTTCCTTGGG - Intronic
947934467 2:233991851-233991873 GAATCCACAAGATAAGCCTTAGG - Intronic
1169682726 20:8233760-8233782 AAAGCCAGAAGATTAGCCTTGGG - Intronic
1169951343 20:11047543-11047565 CAAGCCACAAGTTTATCTTTGGG - Intergenic
1173241195 20:41298903-41298925 GAAGCCACAATATTTGTCCTGGG - Intronic
1175851061 20:62093189-62093211 CAAGCCAAAATAGTATTCTTTGG - Intergenic
1178807845 21:35854361-35854383 GAAGCAGCATTTTTATCCTTTGG - Intronic
1182747963 22:32620366-32620388 GAAGCCACAAGATTTCCCTGTGG - Intronic
1185373443 22:50471226-50471248 GAAGCCCCAGTGTTGTCCTTAGG - Intronic
950914156 3:16626763-16626785 GAAACCACATGATTATCCTGTGG - Intronic
952311016 3:32190416-32190438 GAAGCAAACATATTATCCTGGGG - Intergenic
953664007 3:44912684-44912706 CAAGACACAATATTGTCATTTGG - Intronic
954362163 3:50127653-50127675 CAAGACATAATATTGTCCTTGGG + Intergenic
955496863 3:59542546-59542568 AAAGCCACAAAAATATCGTTTGG + Intergenic
956239960 3:67118661-67118683 GTAGCCACAATATTTTTCATTGG + Intergenic
956573848 3:70729248-70729270 AAAGCCACCATATTAAACTTTGG - Intergenic
956780097 3:72596810-72596832 GAAGCCAGATTATTCTTCTTAGG - Intergenic
958845072 3:99256620-99256642 GGAGTAAAAATATTATCCTTTGG - Intergenic
960305020 3:116050499-116050521 GAAGCCTGAATATGGTCCTTGGG + Intronic
961267405 3:125654714-125654736 GAAGCCAAAATATTCCCCTTAGG + Intergenic
962045278 3:131752290-131752312 GGAGCCACAATATTTTTCTCTGG + Intronic
962249936 3:133829684-133829706 GGAGCCACAAAAGCATCCTTAGG - Intronic
964460843 3:156925482-156925504 GAATCCTCAATATTCTGCTTAGG + Intronic
967079676 3:186037884-186037906 AGGGCCCCAATATTATCCTTAGG + Intergenic
973131936 4:46658589-46658611 GAAGCAACCACATTATCCATTGG + Intergenic
973540676 4:51932311-51932333 AAACCCACAATATTTTCTTTGGG - Intergenic
977964718 4:103131693-103131715 CAAGCCACCAAAATATCCTTTGG + Intronic
978057068 4:104283157-104283179 CAGGCCACAATATTACTCTTTGG + Intergenic
980145240 4:128974890-128974912 GAAGCAAAAATAAAATCCTTTGG - Intronic
982894531 4:160901800-160901822 GCAATCAGAATATTATCCTTTGG + Intergenic
983062645 4:163176129-163176151 GAAGCCACCAAATTAACCCTGGG + Intergenic
986445865 5:7820608-7820630 GAAGCCACAATATGATATCTGGG + Exonic
987519028 5:18954205-18954227 GAAGCCACAATAACTTTCTTAGG + Intergenic
988791017 5:34607722-34607744 AAAGACACAAGCTTATCCTTAGG + Intergenic
989549277 5:42714231-42714253 GAAGCAACAAGATTAACCATTGG - Intronic
990435579 5:55787978-55788000 GAAGCCAGAAAATTTTCTTTTGG + Exonic
992179911 5:74185617-74185639 GAAACCACATTACTATGCTTTGG + Intergenic
993039529 5:82797084-82797106 AAAGCCACAGTACTATCCTAGGG - Intergenic
993156474 5:84230969-84230991 GAAAATACAATTTTATCCTTGGG + Intronic
995345957 5:111117793-111117815 GAAGCCAATATATTATCCATAGG - Intronic
995408648 5:111830423-111830445 AAAGCCACAATGTTTTCCTCTGG - Intronic
1000434351 5:161189759-161189781 GAAGTCACAATTCCATCCTTGGG - Intergenic
1001883952 5:175271392-175271414 GAAGCAATAATATTCCCCTTGGG - Intergenic
1004506714 6:16252910-16252932 GCAGCCACATTGTTATCATTTGG + Intronic
1009450154 6:63790980-63791002 GGAGCATCATTATTATCCTTAGG + Intronic
1011951103 6:92965604-92965626 GAAGACACAGTCTTATCATTAGG - Intergenic
1012713822 6:102643614-102643636 GAAGTCAAAATATTTTCATTGGG + Intergenic
1012868709 6:104647616-104647638 AAAGTCAAAATAATATCCTTGGG - Intergenic
1014274259 6:119368979-119369001 GAGGCCAAAATATTGCCCTTAGG - Intergenic
1014761009 6:125356713-125356735 GAGGCCAAAACAATATCCTTTGG + Intergenic
1021815286 7:24441393-24441415 AGTGCCACAATATTATTCTTAGG - Intergenic
1023121538 7:36914242-36914264 GAAGAAATAATATTATACTTTGG - Intronic
1023336612 7:39177237-39177259 GAAGCTACAAGAATTTCCTTGGG + Intronic
1024565749 7:50678953-50678975 GACGCCAAAATATTTTCCATGGG + Intronic
1032060570 7:128721060-128721082 GAAGACACAATATTATCAGATGG - Intronic
1036909551 8:12743948-12743970 GAAGCCAAATTATTATCCTATGG + Intronic
1039350584 8:36759491-36759513 GAAGCCAATATTTTATCCCTGGG + Intergenic
1041363240 8:57073459-57073481 GAAGACACAAAATCATCCCTAGG + Intergenic
1041472201 8:58223336-58223358 GAAACCTCAAATTTATCCTTGGG - Intergenic
1042051163 8:64709158-64709180 GAAGACACAATCATTTCCTTGGG + Intronic
1050174567 9:2856086-2856108 GAAGCCCCAATAGTATATTTCGG + Intergenic
1050438331 9:5632551-5632573 GGAGCCCCAATATTATATTTTGG + Intronic
1050574773 9:6982724-6982746 GAAAACACAATATTTTCATTAGG + Intronic
1050984828 9:12069352-12069374 TAAGCCACAATGTTACCATTTGG - Intergenic
1054858889 9:69929705-69929727 GAAACCAGAAAATTAACCTTTGG - Intergenic
1061383363 9:130273370-130273392 GAAGCGACAGTATTATAATTTGG - Intergenic
1203582613 Un_KI270746v1:25715-25737 GAGGCTAATATATTATCCTTTGG + Intergenic
1186178275 X:6947954-6947976 CTAACCACAATATTGTCCTTTGG + Intergenic
1187049594 X:15682698-15682720 AAGACCACAATATTCTCCTTGGG - Intergenic
1187057145 X:15751784-15751806 AAGACCACAATATTATTCTTGGG - Intronic
1188536692 X:31204395-31204417 TAAGCCAGAACATAATCCTTGGG + Intronic
1194712142 X:97248981-97249003 GAATCCACAAAAATAACCTTGGG + Intronic