ID: 921474202

View in Genome Browser
Species Human (GRCh38)
Location 1:215586352-215586374
Sequence ATTTGTAATAGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921474197_921474202 26 Left 921474197 1:215586303-215586325 CCAAGGATAATATTGTGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 142
Right 921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 27
4: 262
921474195_921474202 28 Left 921474195 1:215586301-215586323 CCCCAAGGATAATATTGTGGCTT 0: 1
1: 0
2: 1
3: 9
4: 130
Right 921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 27
4: 262
921474196_921474202 27 Left 921474196 1:215586302-215586324 CCCAAGGATAATATTGTGGCTTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921474202 Original CRISPR ATTTGTAATAGGAAGGTGGA TGG Intronic
902658363 1:17884934-17884956 GTTAGTAATGGGCAGGTGGAAGG + Intergenic
902790560 1:18765041-18765063 ATTTGTGATAGGAGATTGGAAGG + Intergenic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
904961189 1:34334359-34334381 AGTTGTCATGGGAATGTGGAAGG + Intergenic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
906616853 1:47239319-47239341 ATCTGTAATAGGAATGGGGTGGG + Intergenic
907504623 1:54908926-54908948 ATCTGTAATATGGAGCTGGAAGG + Intergenic
907611865 1:55879388-55879410 ATTTGTAATAGGATGGTGCTGGG - Intergenic
908423882 1:63986226-63986248 ATTTTTAAAAGGGAGGTAGAGGG - Intronic
908577861 1:65480138-65480160 GTTTTCAATAGGTAGGTGGATGG - Intronic
908610811 1:65858274-65858296 ATTTATAATAAGGAGGTGGCAGG - Intronic
908993903 1:70128815-70128837 TTTTGCAATAGGATGGTTGAGGG - Intronic
909150504 1:71996958-71996980 AATTATAGTAGGGAGGTGGAGGG - Intronic
909185151 1:72478103-72478125 ATTTGTAATAAGACTTTGGAAGG + Intergenic
909459456 1:75893422-75893444 AGTTGGAATAGGAATGTGTAGGG + Intronic
910772426 1:90843590-90843612 ATTAATAATAGGAAGGGGGAAGG + Intergenic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
916530643 1:165653260-165653282 ATGTGTGATAGGAATGGGGATGG - Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918206626 1:182315306-182315328 ATGTGGACTAGGAAGCTGGAGGG - Intergenic
918304180 1:183230823-183230845 ATCTGTATTAAGAAGGTGCATGG + Intronic
919310592 1:195901864-195901886 ATAATTAATAGGAAGGTGGCAGG + Intergenic
920930936 1:210387286-210387308 ATTACTAATAGCAAGCTGGAGGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
924698728 1:246428103-246428125 ATTTGTTAAAGTAAGGGGGAAGG + Intronic
924944380 1:248836544-248836566 AATTGTAACAGGAAGATGGAGGG - Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG + Intronic
1065227141 10:23555828-23555850 AATGGCAATAGGAAGGTAGATGG + Intergenic
1065668956 10:28092874-28092896 GTCTGTGATAGGAAGGTGGCTGG - Intronic
1068528768 10:58161773-58161795 ATTTGTAAAATGAAGGGGGTGGG - Intergenic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1074390404 10:113052835-113052857 ATGTCTAATAGAAAGGTGGGAGG - Intronic
1074489026 10:113922231-113922253 ACTTGTAACAGCAAGGTGCAAGG - Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075427284 10:122351606-122351628 ATTTGTGGTACCAAGGTGGAAGG + Intergenic
1076444235 10:130500855-130500877 ATTTGGAAATGGAAGATGGAAGG + Intergenic
1077895470 11:6450254-6450276 TTCTGTGATAGGAAGGTGCAGGG - Intronic
1079327587 11:19507471-19507493 ATTTGGTATAGAAATGTGGAGGG + Intronic
1082955973 11:58870179-58870201 ATTTTTAATAGGATGGTCAAAGG + Intronic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087436774 11:98129682-98129704 ATTTGTAATAGCAATGTAAATGG + Intergenic
1087947362 11:104179172-104179194 ATTTGAAATAAGAAGGTACAAGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1089121152 11:116136464-116136486 ATTTGTAGTAGGCAGATGTAGGG - Intergenic
1089420513 11:118329949-118329971 TTTTGTTATAGCAAGGTGAATGG - Intergenic
1089974880 11:122723811-122723833 CATTGTAATAGGAAGGAGGCAGG + Intronic
1090240478 11:125177928-125177950 CTTTGTAATAGGGAGTAGGAAGG + Intronic
1090738928 11:129639106-129639128 ACTTGTATGAGGAAGGAGGAAGG - Intergenic
1094723543 12:33089565-33089587 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1096086123 12:48866081-48866103 ATTTGTATTAGGAAGTGGAAAGG + Intergenic
1096257785 12:50073534-50073556 ATTTGCAGGAGGAAGGGGGAAGG - Intronic
1097107006 12:56631899-56631921 ATTTGTAGTGGGGGGGTGGAGGG - Intronic
1097614062 12:61862674-61862696 ATTAGAAATAGCAAGGAGGATGG - Intronic
1097638170 12:62146693-62146715 ATTTGTAACAGGATGTTGCATGG - Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1099008051 12:77259169-77259191 ATTTTTAATAGGATGGTCAAGGG + Intergenic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG + Intronic
1100797552 12:98198298-98198320 ATTTCTCATAGGATTGTGGAAGG - Intergenic
1100881695 12:99025598-99025620 ATTTGAAATAGGAAAGGGCAAGG + Intronic
1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG + Intergenic
1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG + Intronic
1105032639 12:132894805-132894827 ATCTGTAATATGGAGCTGGAAGG - Intronic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1107626989 13:42298086-42298108 AATTGTGATAGGAAGGAAGATGG + Intronic
1108737892 13:53304892-53304914 ATCTGCAATTGGAAGTTGGATGG + Intergenic
1109992564 13:70078236-70078258 TGTTGTAATAAGAAGGTGGTTGG - Intronic
1110755350 13:79167400-79167422 TTTTAGGATAGGAAGGTGGAGGG + Intergenic
1110941044 13:81348834-81348856 ATTTGTAAAAGTCATGTGGAAGG - Intergenic
1112484588 13:99809097-99809119 AATTGTCATAGGAAGCTGGGAGG - Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1114200733 14:20517684-20517706 AATTGTGATAGGAAGAAGGAAGG + Intergenic
1114318926 14:21530593-21530615 ATTTCTAATTGTAAGGTGAAAGG + Intronic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1114481186 14:23035818-23035840 ATTTGAAAAATGAAGGTGGGTGG - Intergenic
1114755248 14:25252574-25252596 ACATGTACCAGGAAGGTGGATGG + Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1116953265 14:50897871-50897893 ATTTGTAACAGAAAGAGGGACGG - Intronic
1117309978 14:54511413-54511435 GTTTGTAATTGGAATGAGGAAGG + Intronic
1117791385 14:59345535-59345557 AGTTTAAATAGCAAGGTGGATGG + Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1119989008 14:79173699-79173721 ACATGTAATAAGAAGTTGGAAGG + Intronic
1120026560 14:79592008-79592030 CTTTGTTATAGGGATGTGGATGG - Intronic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1121192641 14:92043761-92043783 ATCTGTAATACGGAGCTGGAAGG + Exonic
1123887925 15:24746362-24746384 CTTTGTGAAAGTAAGGTGGAAGG - Intergenic
1124269399 15:28266943-28266965 ATTTGTTAAATGAATGTGGATGG + Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1125392602 15:39210827-39210849 ATATCTAATAGAAAGTTGGAAGG + Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126644743 15:50863874-50863896 ATTTTTTAAAGGAAGGGGGAGGG - Intergenic
1126892944 15:53225554-53225576 ATTTGGAATATAAAGGTGGAAGG - Intergenic
1127141674 15:55984268-55984290 ATTAGTAGCAGGAAAGTGGAAGG + Intronic
1127546564 15:59998820-59998842 ATTTGCAAAAGGGTGGTGGAAGG - Intergenic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1130813512 15:87406622-87406644 ATTTATAATAGAAGGATGGAAGG + Intergenic
1130833519 15:87627178-87627200 ATTGGAAATAGGAAGGCGCATGG - Intergenic
1131337662 15:91565233-91565255 AACTGTAATGGGATGGTGGAGGG - Intergenic
1132290399 15:100697012-100697034 ATTTGTAGCAGGAAGATAGAGGG + Intergenic
1133825086 16:9271115-9271137 ATGTATAATAGGTGGGTGGATGG - Intergenic
1135345737 16:21687050-21687072 ATCTGAAGTAGGAAGTTGGAGGG + Intronic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137535044 16:49314413-49314435 ATTGTTACTGGGAAGGTGGAGGG - Intergenic
1139180729 16:64745310-64745332 TTTTCAAATAGGAAGATGGAGGG - Intergenic
1140658989 16:77169310-77169332 ATTTGACATAGGCAGGAGGAAGG - Intergenic
1141229507 16:82152299-82152321 ATTTGTAATAAGAATTTGGTGGG - Intronic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG + Intronic
1144449364 17:15363148-15363170 ATTTTTAATTGGATGGTGGTAGG + Intergenic
1146698037 17:34926500-34926522 ATTTGTTAAAGCTAGGTGGAGGG + Intergenic
1146734859 17:35230062-35230084 ATTTATAGTAGGAAGATGGAAGG - Intergenic
1146822683 17:35997219-35997241 AGTTGGAATAGGAAGTTAGAAGG + Intronic
1147342111 17:39759047-39759069 ATTTGAAATAGGAATGTTAATGG - Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1149072880 17:52563948-52563970 TTCTGTAATAGGAAGATGCATGG - Intergenic
1149386568 17:56148483-56148505 AATTGTGCTATGAAGGTGGAAGG + Intronic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1159804092 18:72934301-72934323 ATTTGTATTCTGAGGGTGGATGG + Intergenic
1161999458 19:7734086-7734108 TTTTGTAAAAGAAAGATGGAAGG + Intergenic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG + Intronic
1168219213 19:54948300-54948322 ACTTGAACTAGGGAGGTGGAGGG + Intronic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
929020625 2:37548795-37548817 TTTTGTAATAGGATGTTGAATGG - Intergenic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932658755 2:73633880-73633902 ACTTGAACCAGGAAGGTGGAGGG - Intergenic
932788839 2:74634252-74634274 ATTTGTAATGAGAAGGTTGGTGG + Intronic
933241555 2:79927062-79927084 ATTTGTTATAGGAATGTGTATGG + Intronic
934044487 2:88161181-88161203 ATTTGTCAAAGGAAGGGGAAAGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
937697185 2:124821007-124821029 CTTTGTCAAAGGAAGTTGGAGGG + Intronic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938968839 2:136413035-136413057 ATTTGTATTATGAAAGTTGAAGG - Intergenic
939396701 2:141639851-141639873 ATTTGTAACAAGAAGGTTGTGGG - Intronic
939551416 2:143620189-143620211 ATTTGTAAAATGAAGATAGAAGG - Intronic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
942161802 2:173196711-173196733 ATTTCTAATAGGAACGTAGATGG - Intronic
942800104 2:179864813-179864835 ATATGTATTTGGAAGGTGAAAGG + Intergenic
943175271 2:184465133-184465155 ATTTTTGAAAAGAAGGTGGAAGG + Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
944884653 2:204049935-204049957 ATTTCATAAAGGAAGGTGGAGGG - Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946634387 2:221708110-221708132 ACTGGGAATAGGAAAGTGGAGGG - Intergenic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
948474782 2:238210341-238210363 ATTCGTGATAGGAGGGTGTAGGG + Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1170518940 20:17163101-17163123 ATTTGTCATAGGAAGATGCTGGG - Intergenic
1171559266 20:26107975-26107997 TTTTGGAATAGTAAGTTGGATGG - Intergenic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1177084405 21:16684590-16684612 GTTTGTGATAGGGAGGTGGTGGG + Intergenic
1177587081 21:23110932-23110954 ATTAGTAATTAGAAAGTGGAGGG + Intergenic
1178835885 21:36097127-36097149 ATTTGTCTCAGGTAGGTGGAGGG - Intergenic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1184177901 22:42800121-42800143 AATTGTAATAAGACGCTGGAGGG + Intronic
951356360 3:21671757-21671779 TTTTATGAAAGGAAGGTGGAAGG + Intronic
952719312 3:36515697-36515719 ATTTGTCTCAGGTAGGTGGAGGG + Intronic
953176628 3:40559381-40559403 GTGTGTAATAGGTAGGTAGAAGG - Intronic
953284739 3:41595603-41595625 AGTTGTACTAGGGAGGTGGGAGG + Intronic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
955726146 3:61935002-61935024 AGCTGTGAAAGGAAGGTGGAAGG - Intronic
955957541 3:64305721-64305743 ATTTGTAATAGAATGGTGTTAGG - Intronic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
960440296 3:117678620-117678642 ATTTGTAATAGGCACGTCTATGG - Intergenic
963059044 3:141210015-141210037 ATCTGTAATATGGAGCTGGAAGG - Intergenic
963320416 3:143804176-143804198 ATCTGTAATATGGAGCTGGAAGG - Intronic
963390914 3:144663130-144663152 ATTTGTAAGAGGAGGGAGGCAGG - Intergenic
964230696 3:154463789-154463811 ACTTATGATGGGAAGGTGGAAGG - Intergenic
964303805 3:155319091-155319113 ATAAGTAATATGAATGTGGAGGG + Intergenic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
970086705 4:12355859-12355881 ATTTGTAATAAGAATGTGGTGGG - Intergenic
970815553 4:20151946-20151968 ATTTCTTATATGAAGGGGGAAGG - Intergenic
971178673 4:24306794-24306816 AGTAGTAATAGGAAGGAGGAAGG + Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
972985614 4:44760788-44760810 CTTTGTAAAATGAAGGTGGCAGG + Intergenic
974208349 4:58736794-58736816 ATTTTTAATACGGAAGTGGAAGG + Intergenic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
976795430 4:88926855-88926877 ATTTTTAATAGCATGGTAGAGGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
979205968 4:118038371-118038393 ATTTCTAATACAAAGATGGAGGG + Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
980769101 4:137348833-137348855 ATTTGTGATAAGAAGGTATAAGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983512352 4:168622212-168622234 ATTTGGCATAGGGAGGAGGATGG - Intronic
985372962 4:189306763-189306785 ATTTTTAAAAGGAAGCAGGAAGG + Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987163137 5:15165996-15166018 ACTTTTAATGGGAAGTTGGAAGG + Intergenic
987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG + Intronic
988173244 5:27686192-27686214 AATTGTGATAGAAGGGTGGAAGG + Intergenic
989553525 5:42764037-42764059 ATTAGTAATAGGGAAGTGGTGGG - Intronic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
991621698 5:68551525-68551547 ATATGCAATAGAAAGGAGGATGG - Intergenic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995038667 5:107563922-107563944 GTTTGTACCAGGAAGGTAGAGGG - Intronic
995399574 5:111725623-111725645 AATTGTGATAGAAGGGTGGAAGG - Intronic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
997675960 5:135713714-135713736 ATTTGAAATATGATGGGGGAGGG - Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999661873 5:153873122-153873144 ATTTCTAATATAAAGGTGGTAGG + Intergenic
999848128 5:155507653-155507675 GTTTGTGTTAAGAAGGTGGATGG - Intergenic
1001302737 5:170548611-170548633 TTTGGTACTAGGAAGGTGGATGG - Intronic
1003870522 6:10399098-10399120 ATTTTGAATAGGAAGGCTGATGG - Intronic
1004131398 6:12923536-12923558 ATTGGTATTAGGAAAATGGAGGG - Intronic
1004138005 6:12987409-12987431 ATTTGTAATAGTTAGGTAGAAGG + Intronic
1007300316 6:40863092-40863114 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1007743200 6:44025230-44025252 AATTGTATTAGGAAGGAGGGTGG + Intergenic
1007803032 6:44413893-44413915 GTTTTTATTAGGAATGTGGAAGG + Intronic
1008760683 6:54848247-54848269 ATTTGCAATTGGAAGGTGTGGGG - Intronic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1016422482 6:143899853-143899875 ATTTGTCATTGAAAGATGGAGGG + Intronic
1018273752 6:162107926-162107948 ATTTGCAAAAGAAAGGAGGAAGG + Intronic
1020846317 7:13288857-13288879 ATTTGTACTGGGAAAGTGTAAGG - Intergenic
1021928094 7:25552558-25552580 AATTGTAATTGGATGGTGGTTGG + Intergenic
1023180230 7:37474984-37475006 ACTTGTTTTAGGAAGGTGGTTGG - Intergenic
1024240482 7:47431234-47431256 AGTTGTAAGAGGAAGGTTTATGG + Intronic
1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG + Intergenic
1025672349 7:63623005-63623027 ATTTGGAATTGGCAGGTAGATGG - Intergenic
1027591076 7:80119932-80119954 ATTTTTAACAGGAAGGGGAATGG - Intergenic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1031816423 7:126443347-126443369 ATAAGTAATACGAAGCTGGATGG - Intronic
1034479079 7:151306032-151306054 AGATGTAATAGGAAGGCTGAAGG - Intergenic
1035047265 7:155975815-155975837 TTTGGTAGTAGGATGGTGGAGGG + Intergenic
1035651537 8:1269420-1269442 AAGTGTTACAGGAAGGTGGATGG - Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1037512817 8:19600872-19600894 ATTTGTTAAATGAAGGAGGAAGG + Intronic
1039486097 8:37911216-37911238 ATTGCTAATATAAAGGTGGAAGG - Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1044505434 8:93011898-93011920 ATTTGCAGTAGGAGGGTGGTGGG - Intronic
1046153875 8:110262346-110262368 ATTTGTAAAATGAAGGGAGAAGG - Intergenic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1048559786 8:135521628-135521650 ATTTGTAATATGAGGTTGGATGG + Intronic
1049138239 8:140925712-140925734 ATTTGTAACTGGAAGATGCAAGG + Exonic
1050259448 9:3826089-3826111 ATTTAAAATAGAAAGGGGGAAGG - Intronic
1050471833 9:6001178-6001200 AGTAGGAATAGAAAGGTGGATGG - Intronic
1050785880 9:9401069-9401091 ATCTGTACTAGGCAGGTGGTAGG + Intronic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1054354326 9:64047047-64047069 AGTTATAATAGGAAGGAGGGTGG - Intergenic
1055270329 9:74550589-74550611 AGTGGTAATTGAAAGGTGGAAGG - Intronic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1059040790 9:110813609-110813631 ATTTGTGATGAGCAGGTGGAAGG - Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1187477197 X:19622159-19622181 ATTTGTAATATGAAGATGACAGG + Intronic
1187880568 X:23843343-23843365 ATTTGTGACAGGGTGGTGGATGG - Intronic
1188172543 X:26945440-26945462 AATTGTAATAGAACAGTGGATGG - Intergenic
1188200286 X:27287955-27287977 ATCTGTAATACGGAGCTGGAAGG + Intergenic
1192425650 X:71073637-71073659 AATGGTAATAGGCAGCTGGATGG - Intergenic
1192573539 X:72225096-72225118 ATTTGCAATAGGAGGGTGTAGGG - Intronic
1193319869 X:80108587-80108609 ATTAATAATAGGAAAGTGGTAGG + Intergenic
1194796949 X:98223547-98223569 ATTTGTAAATGTAAGGTGCAGGG - Intergenic
1195462202 X:105140184-105140206 AGTTCTAATAGGAAGGTAAAAGG - Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197063081 X:122205346-122205368 ATTTGTGATAGGAAGGTGAGGGG - Intergenic
1198422783 X:136484439-136484461 TTTTGCACTAGGAAGTTGGATGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1200882031 Y:8224588-8224610 ACTTGAAATCGGAAGGTGTAGGG - Intergenic
1201862535 Y:18615184-18615206 ATTTGTAATATGAAGATGCAGGG - Intergenic
1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG + Intergenic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic