ID: 921479281

View in Genome Browser
Species Human (GRCh38)
Location 1:215645184-215645206
Sequence TTGTGGGCATGAAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921479281 Original CRISPR TTGTGGGCATGAAGGGAGAA AGG Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900428254 1:2590245-2590267 TTGGGGGCAGGAAGGGAGCCGGG - Exonic
900500085 1:3000063-3000085 GGGTGGGGCTGAAGGGAGAATGG + Intergenic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901379004 1:8860529-8860551 CTCTGGGCAGGAAGGCAGAAGGG - Intergenic
901466591 1:9425624-9425646 TTGGGGGGATGTTGGGAGAAGGG - Intergenic
903839139 1:26225770-26225792 TGGAGGGCATGAAGGAAGGAGGG - Intergenic
904498854 1:30902596-30902618 TTGGGGGGATGATGGGAGCAAGG + Intronic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904771821 1:32885174-32885196 TTGGGGGCAAGGTGGGAGAAGGG - Intergenic
904988484 1:34572578-34572600 TTGTGGGCCAGGAGGAAGAAGGG + Intergenic
905465119 1:38147381-38147403 TTATGGACAGGAATGGAGAAAGG - Intergenic
905958545 1:42022357-42022379 TTATGGGCAGGAAGAGAGCATGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
909982298 1:82117069-82117091 TTATGGCCAGAAAGGGAGAAGGG + Intergenic
911055102 1:93702143-93702165 TTGGGGGCATGAAGTGTGCAGGG - Intronic
912142877 1:106752905-106752927 TTGAGGGCAAGAAGTGAGAGTGG + Intergenic
913085340 1:115431796-115431818 TTCTGTGCCTGAAGGGAGAAGGG + Intergenic
913131592 1:115842560-115842582 TGGTGACAATGAAGGGAGAAGGG + Exonic
913414316 1:118588740-118588762 TTCAGGCCATGATGGGAGAAGGG - Intergenic
913691150 1:121281083-121281105 TTGTGTGCATGAACGGGGACTGG + Intronic
914146391 1:144998879-144998901 TTGTGTGCATGAACGGGGACTGG - Intronic
914959230 1:152191454-152191476 GTGTAGGCATGAAGGGAAAGGGG - Intergenic
915058618 1:153160494-153160516 CTGTTGGCATGAATGAAGAATGG - Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915884064 1:159703882-159703904 GTGTGGCCAGGTAGGGAGAAAGG + Intergenic
916290864 1:163164971-163164993 TGTTGGGCAGGAAGGGAGAGGGG - Intronic
916314041 1:163427753-163427775 ATATCAGCATGAAGGGAGAAAGG - Intergenic
917070462 1:171144946-171144968 TAGTAAGAATGAAGGGAGAATGG + Intronic
917680201 1:177358124-177358146 TGGTGGGAATGAAGGCAGAGAGG + Intergenic
918598657 1:186325265-186325287 TTGTGGGCATTAAAAGAGTATGG - Intronic
918599013 1:186330818-186330840 TTGTGGGACAGAAGGAAGAAAGG + Intronic
919366903 1:196673110-196673132 TGGTATGCAGGAAGGGAGAATGG + Exonic
919946295 1:202321288-202321310 GCGTGGGCAAGAAGTGAGAAGGG - Intergenic
920160994 1:203997527-203997549 TTGTGGGCACAAAGGAGGAAGGG - Intergenic
920278652 1:204827250-204827272 GTGTGGGCCTAAAGGGAGCATGG - Intergenic
920478474 1:206299559-206299581 TTGTGTGCATGAACGGGGACTGG + Intronic
920536579 1:206741250-206741272 TTTTGGGCATGTAGGCAGAATGG + Intergenic
920674152 1:208027434-208027456 TTATGTGCATGAAGGCAGAATGG - Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
922775682 1:228213336-228213358 TTGTGGGCGGGAAAGGAGACTGG - Intronic
923501933 1:234572308-234572330 TGGTGGGAAGGCAGGGAGAAGGG - Intergenic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
924852045 1:247840344-247840366 TTGTGGGAAGGAAGGGAGGGAGG - Intergenic
1062768856 10:84330-84352 CTGTGGGCAGGAAGGGCCAAGGG + Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1067468106 10:46516383-46516405 GAATGGACATGAAGGGAGAAGGG - Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1069869857 10:71526475-71526497 TTAGGGGCATGAAGGAGGAAGGG + Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1072295219 10:94002664-94002686 TTGAGGGGAAGAAAGGAGAAGGG + Intronic
1072628322 10:97128556-97128578 TTGTGGGCATCAGGGCAGGAGGG - Intronic
1073320260 10:102611914-102611936 TTGGGGGCTGGAAGGGAGAGGGG - Intronic
1073518585 10:104102523-104102545 TTGTGGGTGTGATGAGAGAAAGG + Intergenic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1075130388 10:119733053-119733075 TTGTAGTCAAGAAGGTAGAAAGG - Intronic
1075132012 10:119748380-119748402 TTGTGGGCAACAAGGAGGAAAGG - Intronic
1075685867 10:124364754-124364776 TGGTGGGAAAGAAGGGAGCAGGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076251063 10:128984237-128984259 TTGTGAGCATGAAGTGTGCATGG - Intergenic
1076980840 11:203912-203934 TGGTGAGCATGGATGGAGAAAGG + Exonic
1077414386 11:2418019-2418041 CTGTGGGCCTGAAGCGAGAGTGG + Intronic
1078085568 11:8231392-8231414 GTGTGGGCATGAAGTGACAGAGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079440289 11:20507392-20507414 TTGTGGTCATAAAGGGTCAATGG - Intronic
1082572309 11:54758837-54758859 TTGGGAGCATGATGGGAGACTGG - Intergenic
1082783452 11:57303610-57303632 CTGGGGGCATAAAGGCAGAAAGG - Intronic
1083143147 11:60738167-60738189 TTATGGGGATGAAGAGAGAAAGG - Intronic
1085043599 11:73340991-73341013 TGCTGGGCATGTGGGGAGAAGGG + Intronic
1085428060 11:76422514-76422536 AAATGGGCATGAAGGAAGAAAGG + Intergenic
1086971585 11:93086458-93086480 GTGTGGGAATTAAGGGAGATGGG + Intergenic
1087032852 11:93723429-93723451 TTGAGGGCATTTAGTGAGAAAGG + Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087863864 11:103198730-103198752 TAGAGTGCAGGAAGGGAGAAAGG - Intronic
1088005350 11:104933054-104933076 TTTGGGGCATGAAGGGGAAAGGG + Intergenic
1088546530 11:110965105-110965127 AAGTGGCCATGAAGGGAGAGAGG + Intergenic
1088826071 11:113495759-113495781 TTGGGGGCAGGAAGGAAGGATGG + Intergenic
1089768386 11:120785071-120785093 GAGTGGGAATGAAGGCAGAAGGG - Intronic
1091025524 11:132137683-132137705 TTTTAGGCCTGAAGGGATAAGGG + Intronic
1092131686 12:6117527-6117549 CTGTGAGCATCAAGGGAGACAGG - Intronic
1093234408 12:16588874-16588896 CTGTTGTTATGAAGGGAGAATGG - Intronic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094392182 12:29963659-29963681 TTGTGGGGAGGAATAGAGAAAGG + Intergenic
1094477490 12:30852446-30852468 ATGGAGGCATGCAGGGAGAAAGG - Intergenic
1095622836 12:44279246-44279268 TTATGTTCATGAATGGAGAAGGG - Intronic
1096107039 12:49002362-49002384 TTGTGCATATGAAGGGAGATGGG - Exonic
1096356107 12:50942346-50942368 TTGTGGGCAGTAAGTGAGAGGGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097174114 12:57133042-57133064 TTGTGGGCTAAGAGGGAGAAAGG + Intronic
1097314021 12:58152879-58152901 TTATGGACAAGAATGGAGAAAGG + Intergenic
1102650485 12:114438949-114438971 AATTGGGCATGAAGTGAGAAAGG + Intergenic
1103417458 12:120752593-120752615 TCATGGGGATGGAGGGAGAAGGG + Intergenic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1104380934 12:128307272-128307294 GTGTTATCATGAAGGGAGAAAGG + Intronic
1104763842 12:131313882-131313904 GTGTGGCCATGAAGAGAGAAAGG - Intergenic
1105768690 13:23586607-23586629 TTTTGGGCAAGAAGGCACAAGGG + Intronic
1106199527 13:27524673-27524695 TTGTTGGCATGAAGGTTGATGGG - Intergenic
1107200439 13:37709530-37709552 ATGTGTGCATGAAGGAGGAAAGG - Intronic
1107849280 13:44554154-44554176 TTGTGAGGATAAAAGGAGAAAGG - Intronic
1108743758 13:53367765-53367787 CTGTAGGCAGGAAGGAAGAAAGG + Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1109737709 13:66508241-66508263 TTGTGGGGATTAGGGGAGGAGGG + Intronic
1109986541 13:69993645-69993667 CTCTAGGCCTGAAGGGAGAAGGG - Intronic
1110703775 13:78580598-78580620 ATGTGGACATGAAGAGAGTATGG - Intergenic
1111418808 13:87983207-87983229 TTGTGTGACTGAAGGCAGAAGGG - Intergenic
1111448915 13:88389200-88389222 TGGTGAGCATGCAGTGAGAAGGG + Intergenic
1111979410 13:95001488-95001510 ATGTTGGCATGTATGGAGAATGG - Intergenic
1112226873 13:97548178-97548200 TTGTGGGGGTGAAGGTGGAATGG + Intergenic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1112940895 13:104860714-104860736 TAGAGGGGGTGAAGGGAGAAGGG + Intergenic
1114441051 14:22748140-22748162 TTGGGGGCATGAAGAAATAATGG - Intergenic
1114529180 14:23384786-23384808 TTGAGGGCCTGATGGGAGAAAGG - Intronic
1115127895 14:30018280-30018302 TTCTGAGGATGAAGGTAGAATGG - Intronic
1117270578 14:54139309-54139331 GTGTGTGCATGGAGGGAGAGTGG - Intergenic
1117536895 14:56711085-56711107 TTGGGGGCATGGATGAAGAAAGG - Intronic
1118636217 14:67750965-67750987 TTGTGGGGAGCAAGGGATAAAGG + Intronic
1118882421 14:69840969-69840991 TTGTGGGCACAAAGGAGGAAGGG - Intergenic
1119295594 14:73530490-73530512 TTGAGGGCAAAAAGGGAGAAAGG - Intronic
1119299242 14:73558218-73558240 TTGAGGGCAAAAAGGGAGAAAGG - Intronic
1119378467 14:74213899-74213921 TGGTGTCCATGAAGGGAGGAGGG - Intergenic
1119996048 14:79254857-79254879 TTGGAGGGAGGAAGGGAGAAAGG - Intronic
1120719060 14:87870696-87870718 TTTTGGGGAGGAAGGAAGAAGGG - Intronic
1120762577 14:88298836-88298858 TTGGGGGCATGAAGGTGGAAAGG - Intronic
1121861608 14:97324079-97324101 GGGTGGCCATGAAGGGAGCAGGG - Intergenic
1121940440 14:98065086-98065108 TTGTGTCCATGAAGTAAGAAGGG + Intergenic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122530633 14:102423791-102423813 TTGGGGGCAGGAAGGGACATTGG + Intronic
1124168950 15:27354927-27354949 TCCTGGGCATGAACAGAGAATGG - Intronic
1125015288 15:34927720-34927742 ATGTGGGCATCAAGGAAGACAGG - Intronic
1125495126 15:40186118-40186140 TAGTGGTAATGAAAGGAGAAGGG + Intronic
1125539905 15:40464284-40464306 TGTTAGGCATGGAGGGAGAAGGG - Intronic
1125824583 15:42665567-42665589 GTGTGGGCAGGTACGGAGAATGG + Intronic
1126458133 15:48886840-48886862 TTATGGGAATGAGAGGAGAAGGG + Intronic
1126658475 15:51006984-51007006 TTGGGGGCAGGAGGGCAGAAGGG - Intergenic
1127735649 15:61836232-61836254 TTGTGGGCATGCACGGAGATGGG + Intergenic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1128918758 15:71591909-71591931 TTGTGGGCCTGATGGGTGACAGG + Intronic
1131063929 15:89421369-89421391 AGGTGGGCACGAAGCGAGAAAGG - Intergenic
1132202452 15:99964281-99964303 CAGTGGACATGAAGGTAGAAGGG + Intergenic
1132273845 15:100549304-100549326 TTGAGGGCATGGAGAGGGAATGG + Intergenic
1133559460 16:6937288-6937310 ATGTGGGAATGAAGGTAAAAAGG - Intronic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1135723839 16:24839236-24839258 TTGTGCCCAGGAAGGGAGGAGGG + Intergenic
1136081505 16:27855217-27855239 TTGTGGGGATCAAAGGAGAATGG - Intronic
1137093318 16:36221659-36221681 GAGTGGGGAGGAAGGGAGAAAGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137548426 16:49419808-49419830 TTCTGGGCTTGAAGCCAGAAAGG - Intergenic
1139235193 16:65330889-65330911 AAGTGGGCAGGAAGGAAGAAAGG + Intergenic
1139952093 16:70677460-70677482 TTCTGGCCATGAAGGGAGGTGGG + Intronic
1140216115 16:73010308-73010330 TCGTGGGGATGAATGGGGAACGG - Intronic
1140301696 16:73764219-73764241 TTGGGGGCAAGAAGTGAGCAGGG - Intergenic
1140344563 16:74200292-74200314 TTGGGGTCAGGAAGGGGGAAGGG + Intergenic
1140388221 16:74561253-74561275 TTGTGGTCATGAAGGGTGTGAGG - Intronic
1140908493 16:79430142-79430164 ATGTGAGGATGCAGGGAGAAGGG - Intergenic
1141044997 16:80708050-80708072 TATGGGGCATGAAGGGGGAAAGG - Intronic
1142511222 17:394727-394749 TTGTGGGCTAGAAGGAAGGAGGG + Intergenic
1142592616 17:1012954-1012976 GTGTGGGCAGGAGGGGAGAGGGG + Intronic
1143104229 17:4520364-4520386 CTGTGGGCAAGAGGAGAGAATGG + Intronic
1143332000 17:6144377-6144399 TTGTGGCCATGCAGCGTGAATGG + Intergenic
1143875585 17:9988304-9988326 TTCTGGGTAGGAAGGGAGAAGGG - Intronic
1143899542 17:10163709-10163731 TTGGGGGCTTGCTGGGAGAATGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1145087677 17:19956489-19956511 AAGTGGGAATGAAGGGTGAAAGG + Intronic
1146678754 17:34792053-34792075 TTGGGGCCATGAAAGGAGGATGG + Intergenic
1147219907 17:38922466-38922488 TTGTGAGGAAGAAGGAAGAAAGG - Intergenic
1147589795 17:41674943-41674965 TTGGGGGCAAGCAGGGAGCAGGG + Intergenic
1151338796 17:73456545-73456567 GTGTGGGCATGCTGAGAGAATGG + Intronic
1151399101 17:73843932-73843954 TTGGGGGCATGAGGGGAGTGGGG - Intergenic
1151744495 17:76004653-76004675 TTGTGGGCAAGAATGGACAGTGG - Intronic
1151983679 17:77528735-77528757 GTGGGGGCATGGAGGGAGAGAGG + Intergenic
1152556425 17:81055356-81055378 TTGTGGGCATGAATGGGACAGGG + Intronic
1153749233 18:8211820-8211842 TTGTGGAAACGAAGGGTGAATGG + Intronic
1154103417 18:11498509-11498531 TTTTGCCCATGAAGGCAGAAAGG - Intergenic
1154460687 18:14581920-14581942 TTGTAGGCATGGTGGTAGAAAGG - Intergenic
1155445088 18:25902714-25902736 TTCTGCGCATGAAGGAACAAAGG + Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1157432966 18:47644720-47644742 TTGAGGGCTTGATGGTAGAAAGG - Intergenic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1158708864 18:59819089-59819111 TTGAAGGTTTGAAGGGAGAATGG + Intergenic
1159418592 18:68184926-68184948 TTCTGGGCATGGAGGGTGACAGG + Intergenic
1159488498 18:69098031-69098053 TCGTGGGCAAGGAGAGAGAATGG - Intergenic
1160828903 19:1093668-1093690 TCGTTGGCAGGAAGAGAGAAGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1162222251 19:9187644-9187666 TTGGTGACTTGAAGGGAGAAAGG - Exonic
1162439434 19:10683468-10683490 TTGTTGGCATCAAGGGCGAGAGG - Exonic
1164785486 19:30927118-30927140 ATGTTGGCATGAAGGAAGCAGGG - Intergenic
1165775118 19:38399668-38399690 TTGAGGGTCTGATGGGAGAAGGG - Intergenic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166865017 19:45830520-45830542 TTGTGGGCACGAGTGGAGGAGGG + Intronic
1167411142 19:49344588-49344610 TTGCGGGCTTCAAGGGAAAAAGG - Intronic
1167442143 19:49514520-49514542 AGGTGGGCATGACGGGAGAGAGG - Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1168271214 19:55250794-55250816 TGGTGGTCATGCAGGCAGAAGGG - Intronic
1168470188 19:56633566-56633588 TTCTGGGCATGATCAGAGAATGG + Intergenic
1168538655 19:57192230-57192252 TTGGGGGCCTGAGGGGGGAAGGG + Intronic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927092955 2:19726560-19726582 TTGTGGGCATTCAGGGATATTGG - Intergenic
928405828 2:31014255-31014277 TTTTGGGGAGGAAGGGGGAAGGG - Intronic
929299538 2:40287614-40287636 GTGTGTGCATGCAGGGACAAGGG + Intronic
929489230 2:42381806-42381828 TTGGGATCATGAAGGGAAAAAGG + Intronic
932168514 2:69531485-69531507 TTGTGGACATGAGGAGAAAATGG + Intronic
932753251 2:74386145-74386167 TTGTGGGCATGATGGTGGCATGG - Intronic
932796463 2:74700112-74700134 TTGGGGGCATGAAAGGACAGTGG + Intergenic
933167862 2:79095250-79095272 TTGTCGGTATAGAGGGAGAAAGG + Intergenic
933548453 2:83743424-83743446 TGGAGTGCATGAAGGGACAAAGG - Intergenic
934786878 2:97016351-97016373 TTGTTGGGATGCAGGGAGTATGG - Intronic
936480072 2:112877763-112877785 TTGTGGGAATTAAAGGAGATGGG - Intergenic
937263177 2:120599275-120599297 ATGTGGGCGTGAAGGCAGGAGGG + Intergenic
937373843 2:121321793-121321815 TTGTGGGGAGGAAGGGTGACAGG - Intergenic
937777046 2:125790276-125790298 TTTTGGGCATGATGTGAGGAAGG - Intergenic
938926516 2:136048100-136048122 CTGTTAGCAAGAAGGGAGAATGG + Intergenic
939201430 2:139040803-139040825 CTGTGATCATGAAGAGAGAATGG + Intergenic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
943732208 2:191313941-191313963 TTGTGCCCGGGAAGGGAGAATGG + Intronic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
947061935 2:226176677-226176699 GTGTTTGCATGAAGGAAGAAAGG + Intergenic
947383377 2:229566670-229566692 TTGTGAGCCTGATGGGAGAGAGG - Intronic
947785004 2:232809450-232809472 TTAAGGGCAGGAATGGAGAATGG + Intronic
1169043412 20:2516049-2516071 TTGAGGTGATGAAGTGAGAATGG + Intronic
1169087670 20:2837532-2837554 TTGTGTGCATGCAGGGACTAGGG + Intronic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1169682749 20:8234117-8234139 TTGTGGGATTGAAGGTGGAATGG + Intronic
1169898151 20:10526097-10526119 ATGTGCGCATGAAGGAAGGAGGG - Intronic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1170107897 20:12771816-12771838 TGGTGGGAATGAAGGGCTAATGG + Intergenic
1170910620 20:20563653-20563675 ATGTGGGCATGATAGGATAAAGG - Intronic
1171854181 20:30329919-30329941 TTTTGGGCTTGCAGAGAGAATGG - Intergenic
1172388189 20:34548398-34548420 TTGAGGTCACGGAGGGAGAAGGG + Intronic
1172460728 20:35116410-35116432 GTGAGGGCAGGAAGGGAGCAGGG - Intronic
1173042223 20:39475202-39475224 TGGTGGTCATAAAGGGAAAAGGG - Intergenic
1173483936 20:43426627-43426649 TTGTAGGAAGGAAGGGAGAAAGG + Intergenic
1174719827 20:52799722-52799744 TTGCGCCCATGAAGAGAGAAAGG + Intergenic
1175353080 20:58340084-58340106 TTGTGGGGTTGAGGGGAGAAAGG + Intronic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1182179514 22:28331709-28331731 TTGAAGGCAAGAAGGGAGGAAGG - Intronic
1182188161 22:28429325-28429347 TTGAGGCCCTGGAGGGAGAAAGG - Intronic
1182359001 22:29735701-29735723 TTGGGGGCATTCAGGGAGATTGG - Intronic
1183581905 22:38731347-38731369 CTGTGGGCTTAAAGGGAAAAAGG - Exonic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
950011892 3:9729866-9729888 TTATTGGCATGAAGGCAGAGAGG - Exonic
950249177 3:11449741-11449763 TTGAGGGCACAAAGGGGGAAAGG - Intronic
950443031 3:13020892-13020914 TTTTGGGAAGGAAGGAAGAAAGG + Intronic
951692045 3:25406719-25406741 TAATGGGAATGAAGGGAGAAAGG + Intronic
951752545 3:26053703-26053725 TTTTGGTGATGAAGGGAAAAAGG + Intergenic
952204065 3:31162140-31162162 CTGTGGGCATGAATGTGGAATGG + Intergenic
952286063 3:31970882-31970904 TTGGAGGCATGAAAGGAGATAGG - Intronic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952515999 3:34105215-34105237 TGATGGGAGTGAAGGGAGAAGGG - Intergenic
952978139 3:38713644-38713666 TGGAGGGCATAAAGGGGGAAGGG + Intronic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
954368854 3:50159858-50159880 TTGTGGGGGAGAAGGGAGACCGG + Intronic
954680958 3:52345709-52345731 TTGTGGGCATCAAGGGCACAGGG + Intronic
955542735 3:59994988-59995010 TTGTGGGTACGAAAGGAGAGAGG + Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956744538 3:72301064-72301086 TTGGGGGCAGGAAGGGATAGTGG - Intergenic
956858054 3:73295058-73295080 TTGGAGGCATGAGAGGAGAAAGG + Intergenic
957797784 3:85034261-85034283 TGGGGGGCAAGAAGGGGGAATGG - Intronic
958779462 3:98523169-98523191 TTTTAGGGAGGAAGGGAGAATGG + Intronic
962321598 3:134395210-134395232 TTGTGGGCAAAAGAGGAGAATGG - Intergenic
963108252 3:141664665-141664687 TTGGGGGAAGGAAGGGAGAGAGG - Intergenic
963831521 3:150014266-150014288 CTGTGGGCCAGATGGGAGAAGGG + Intronic
964557997 3:157962209-157962231 TTGTGGCCATGCAGGTAAAATGG - Intergenic
965372384 3:167879679-167879701 TTGTGTGCATGAGGGGAGAGAGG - Intergenic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
967719898 3:192804958-192804980 TTCTGGGCATGAACGAGGAAAGG - Intronic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968434302 4:576715-576737 TTATGGGGATGCAGGGAGAGGGG + Intergenic
969412859 4:7041265-7041287 ATCTGGTCAAGAAGGGAGAAAGG + Exonic
970169472 4:13275453-13275475 TTGTGGGAAAGATGGGAGATGGG - Intergenic
970535440 4:17025600-17025622 TTGTGTGCATGTAGAGAGAATGG + Intergenic
971259490 4:25043373-25043395 TTGTGGGCTTTGGGGGAGAAGGG + Intergenic
971654324 4:29322492-29322514 TTGTGGGCTTGAAGGTGAAATGG + Intergenic
973310387 4:48703480-48703502 TAGCTGGCATGCAGGGAGAAGGG - Intronic
974379577 4:61121449-61121471 TGGAGGGCATGGAGGGGGAAAGG - Intergenic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
975957424 4:79858009-79858031 TATTGGGCATGAAGGCAGAGAGG - Intergenic
981291762 4:143084650-143084672 ATGTGGGGAGGAAGGGGGAAAGG - Intergenic
981421483 4:144555450-144555472 TTTTGGGAATGTATGGAGAAGGG - Intergenic
985141592 4:186845536-186845558 TAGTGGACATGAAGGGGAAATGG + Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985525884 5:401433-401455 TTGTGGCCATGGAGGGACCATGG - Intronic
985865244 5:2509343-2509365 CTGAGGGCATGAACAGAGAAAGG - Intergenic
987584006 5:19831031-19831053 TTGTGAGAGTGAAGGGTGAAAGG + Intronic
988926779 5:35998201-35998223 TCGTGTGCAAAAAGGGAGAAAGG - Intergenic
989079942 5:37607929-37607951 TTGTTGGCATGATGTGAGAGAGG + Intronic
989766310 5:45088525-45088547 ATGTGAGGAAGAAGGGAGAAAGG - Intergenic
990023184 5:51154087-51154109 TTGTGAGGATGCAGAGAGAAGGG + Intergenic
990159711 5:52924144-52924166 TGGTAGGAAGGAAGGGAGAATGG - Intronic
990301970 5:54458456-54458478 TAGTGGGCAAGAGGGGAGAATGG + Intergenic
990783111 5:59388927-59388949 TTTTGGGGATGAAGAGATAATGG + Intronic
991455519 5:66799407-66799429 TTTTGGGGATGAGGAGAGAAGGG - Intronic
991723118 5:69512233-69512255 TTTTGGGCATGATGGAAGCAAGG + Intronic
992007303 5:72490578-72490600 TGCTGGGCATGGAGGGACAATGG + Intronic
992467208 5:77018380-77018402 TCGTGGGCACCAAGGGAGGATGG + Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
993440944 5:87956103-87956125 ATGTGGGCAACATGGGAGAAAGG - Intergenic
994356312 5:98797609-98797631 TTCTGGGAATGAAGACAGAATGG - Intronic
995375776 5:111472694-111472716 TTGAGGTCATGAACTGAGAAAGG - Intronic
995441695 5:112199328-112199350 TTCTGGGAATGAAGAGAGAAGGG + Intronic
999371725 5:151059582-151059604 AAGTGGGAAGGAAGGGAGAATGG + Intronic
999630740 5:153568739-153568761 TGAAGGGCATGAAGGGAGGAAGG - Intronic
1000281299 5:159784728-159784750 GGGTGGGCATTAAGGAAGAAGGG - Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002642682 5:180637901-180637923 CTGTGGCCATGAAGGGGGATAGG - Intronic
1003354335 6:5352505-5352527 AGGTGAGCAGGAAGGGAGAACGG + Intronic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004570512 6:16840244-16840266 TTTTGGAAATGAAGGAAGAAAGG - Intergenic
1005064781 6:21807642-21807664 TAGTGGGCAAGAAGAGAAAAGGG - Intergenic
1005289637 6:24366605-24366627 GTGTGGACATGCAGGAAGAAGGG + Intergenic
1006080436 6:31562312-31562334 TGGTGGGCATGAGGTCAGAATGG + Intergenic
1006977555 6:38117462-38117484 ATGTGGTCAAGAAGAGAGAAAGG - Intronic
1007044001 6:38753075-38753097 TGGTGGGGAGGAAGGGAGAGAGG - Intronic
1007164051 6:39815832-39815854 TTGTGAGCACCAAGGGAGAGAGG - Intronic
1008444767 6:51575358-51575380 TTCTGGGCAGACAGGGAGAAAGG - Intergenic
1008456433 6:51716467-51716489 TTGTGACCCTGAAGTGAGAATGG - Intronic
1010042770 6:71406228-71406250 ATGTGGACATGAGAGGAGAAGGG - Intergenic
1010346027 6:74811659-74811681 TTTTGGGCAGGAAGGGAGAAAGG - Intergenic
1010725773 6:79331017-79331039 TTGGGGGGATGCCGGGAGAAAGG - Intergenic
1011027969 6:82890306-82890328 TATAGGGCATGAAGGGAAAAGGG - Intergenic
1011381053 6:86742534-86742556 TAGTGGACAGGAGGGGAGAAGGG + Intergenic
1012841039 6:104329407-104329429 TTCTGACCATGAAGGGAAAAAGG - Intergenic
1013089695 6:106888911-106888933 GTGAGGGCGTTAAGGGAGAAGGG - Intergenic
1013983855 6:116166037-116166059 CTGGGGTCATGAAGGTAGAAAGG + Intronic
1015649589 6:135440832-135440854 GGGTGGGCGTGAGGGGAGAAAGG + Intronic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1015885345 6:137911952-137911974 TGCTTGGCTTGAAGGGAGAAGGG - Intergenic
1015994118 6:138980438-138980460 CTGTGGACAAGAGGGGAGAATGG - Intronic
1016848237 6:148590597-148590619 TTTTGGGCATGAATGGACAGGGG - Intergenic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1017676094 6:156815460-156815482 GTGTGGGGAGAAAGGGAGAAAGG - Intronic
1018563487 6:165126970-165126992 TTGTGGGCTTTCAGAGAGAATGG - Intergenic
1021127464 7:16868785-16868807 TTGTGAGCATCAAAGGAGATAGG + Intronic
1021367422 7:19797038-19797060 TGGTGGGCATGTAGAGAAAAGGG - Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022665986 7:32410824-32410846 TTGTGGGCCTGAAGGAGCAAGGG - Intergenic
1024361893 7:48476830-48476852 ATGGGGGCATGAAGTGGGAAAGG + Intronic
1024725117 7:52185461-52185483 GGGCTGGCATGAAGGGAGAATGG - Intergenic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026255222 7:68705353-68705375 TTCTAGGCATGGAGGAAGAAGGG - Intergenic
1029160996 7:98551787-98551809 CTGTGGGCATGAATGAATAATGG + Intergenic
1029899980 7:104028945-104028967 CTTTGTGCCTGAAGGGAGAAAGG - Intergenic
1030149663 7:106390954-106390976 TTGGGGGGATAAAGGGAGATTGG + Intergenic
1030537837 7:110791162-110791184 TTATGTGCATGTTGGGAGAAAGG - Intronic
1031446247 7:121858159-121858181 TTGTAGGCTTTAAGGGGGAAAGG + Intergenic
1031968468 7:128045779-128045801 TTGTGGTCATGGGGAGAGAATGG - Intronic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032479733 7:132236658-132236680 TGCTGGGCACGAAGGGAGAAGGG + Intronic
1033158925 7:138980428-138980450 GTCTGGGCATGAAAGGAGTAAGG - Intronic
1033234712 7:139629189-139629211 TGGTGTGGATGAAGAGAGAAGGG - Intronic
1034386696 7:150746332-150746354 TTGGGGGCTTGCAGGAAGAAAGG - Intronic
1034426536 7:151016992-151017014 TTGTGGGGGTGAAGGCAGAAGGG + Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1035937010 8:3852312-3852334 TTGTAGGGAGCAAGGGAGAATGG + Intronic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040839690 8:51772040-51772062 GTGTGGGCATGGAGGAAGAGGGG - Intronic
1040946541 8:52891195-52891217 TTGTGGTTATCAAGAGAGAAAGG - Intergenic
1041916693 8:63145907-63145929 TTGAGGGTTTGAAGGGGGAAAGG + Intergenic
1042494217 8:69437937-69437959 TTGTAGCCATGTAAGGAGAATGG + Intergenic
1043544610 8:81301210-81301232 TTCTGGCCATGATGGGAAAAGGG - Intergenic
1043950061 8:86298839-86298861 CTGTTGACAGGAAGGGAGAAGGG + Intronic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1047347293 8:124040522-124040544 TTGTGAGTATTAAGGGAGATGGG + Intronic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048451143 8:134534909-134534931 GTGACAGCATGAAGGGAGAAGGG - Intronic
1048932536 8:139326411-139326433 TAGTGGCCAGGAAGGGAGATAGG - Intergenic
1048962691 8:139593678-139593700 GTGTGGGCCTTAAGGGGGAAGGG + Intergenic
1049224723 8:141444738-141444760 TTTTGGGCATGCAGAGAGAGTGG + Intergenic
1049231170 8:141482951-141482973 TTGAGGGCAGGACGGGAAAATGG - Intergenic
1050268658 9:3918320-3918342 TTGTGAGCAGGGAGGGAGACTGG + Intronic
1050562219 9:6845702-6845724 TAATTGGCATGAAAGGAGAAAGG + Intronic
1051548892 9:18306927-18306949 TTAAGGGCAGGAAGAGAGAAAGG + Intergenic
1052062636 9:23979573-23979595 TTTTGGGTATGTATGGAGAATGG + Intergenic
1052175773 9:25461236-25461258 TTCTGTGCATTATGGGAGAAAGG + Intergenic
1052801297 9:32970581-32970603 CTCTGGGCATGAAGAGGGAACGG + Intergenic
1053380824 9:37648928-37648950 TGGTGAGAGTGAAGGGAGAAAGG + Intronic
1053791989 9:41693200-41693222 TTTTGGGCTTGCAGAGAGAACGG - Intergenic
1053944454 9:43292132-43292154 ATGAGGGAAGGAAGGGAGAAAGG - Intergenic
1054153164 9:61621565-61621587 TTTTGGGCTTGCAGAGAGAACGG + Intergenic
1054180394 9:61905219-61905241 TTTTGGGCTTGCAGAGAGAACGG - Intergenic
1054472959 9:65552769-65552791 TTTTGGGCTTGCAGAGAGAACGG + Intergenic
1054657197 9:67675923-67675945 TTTTGGGCTTGCAGAGAGAACGG + Intergenic
1054703969 9:68444203-68444225 TGGTGGGCATTGAGGGAGACTGG + Intronic
1054714507 9:68543562-68543584 TTTTGGGCATCAAGGGGAAAAGG + Intergenic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1057025704 9:91732762-91732784 TTGCGGGCATGAGAGGAGACAGG - Intronic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1057955786 9:99406785-99406807 TTCTGGGCGGGAAGGGAGAGAGG - Intergenic
1058247930 9:102654107-102654129 ATTTGGGCATGCAGGGTGAAAGG + Intergenic
1058675414 9:107395975-107395997 TTGTGGCCATGAAGGAATCAGGG + Intergenic
1058689164 9:107504761-107504783 TAGTCAGCAGGAAGGGAGAAGGG + Intergenic
1059766574 9:117389197-117389219 GGGTGGGCAAGAGGGGAGAAAGG + Intronic
1060018418 9:120107377-120107399 GTTTGGGAATGCAGGGAGAAAGG + Intergenic
1061847258 9:133394719-133394741 TTGTGAGCATGAAGGCTGCACGG + Intronic
1062446723 9:136598339-136598361 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446751 9:136598437-136598459 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446765 9:136598486-136598508 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446779 9:136598535-136598557 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446792 9:136598584-136598606 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446798 9:136598609-136598631 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1203587590 Un_KI270747v1:20710-20732 ATGAGGGAAGGAAGGGAGAAAGG - Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1185635484 X:1548883-1548905 TTCTGGGCATGGATGGAGATGGG + Intergenic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1187682248 X:21779108-21779130 TTGGGGGTATGAAGGAAGTAGGG - Intergenic
1187838835 X:23464178-23464200 TTGATGGCATGCAGGGAGACTGG + Intergenic
1188410060 X:29860906-29860928 TTGTGGGCAGGAATTTAGAAAGG - Intronic
1189025750 X:37392080-37392102 TTGTGTCCATGAACTGAGAATGG + Intronic
1189439198 X:41019209-41019231 ATGTGAGCATAAGGGGAGAAGGG - Intergenic
1192179512 X:68907610-68907632 CTGAGGCCAGGAAGGGAGAAAGG + Intergenic
1192776527 X:74251322-74251344 TTGTGAGCAGTAAGGGAGATAGG - Intergenic
1194995344 X:100586149-100586171 TTGTGAGCATGAAGGGACTATGG - Intronic
1195365264 X:104118212-104118234 TAATGAGAATGAAGGGAGAAAGG - Intronic
1195593777 X:106664195-106664217 TTTCTGGCAGGAAGGGAGAAGGG + Intronic
1195854797 X:109319320-109319342 TTATGGGCAGCAAGAGAGAAAGG - Intergenic
1196003964 X:110815685-110815707 TTCTCAGCAGGAAGGGAGAAAGG - Intergenic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1197714999 X:129700240-129700262 TGCTGGGCATGAGGGTAGAACGG - Intergenic
1198162640 X:134022739-134022761 TTGGGGGCCTGAAGTAAGAATGG - Intergenic
1198317017 X:135478137-135478159 TTAATGGCATGAAGGCAGAAAGG - Intergenic
1199192809 X:144991415-144991437 TTGTCTCCAGGAAGGGAGAATGG + Intergenic
1199324169 X:146477054-146477076 TTGGGGGCTTAAAGGGAAAAAGG + Intergenic
1199673257 X:150163984-150164006 TGGTGGGCATGGAGGCAGATTGG + Intergenic