ID: 921480490

View in Genome Browser
Species Human (GRCh38)
Location 1:215659326-215659348
Sequence CAGCCACACTGGCCTTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 2, 1: 7, 2: 20, 3: 76, 4: 378}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921480490_921480500 25 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480500 1:215659374-215659396 CAATGGGATGAGGACAGAATTGG 0: 1
1: 1
2: 2
3: 30
4: 338
921480490_921480493 -6 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480493 1:215659343-215659365 TGGCTGACCTTAGTGAGTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
921480490_921480496 8 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480496 1:215659357-215659379 GAGTAAGGGCCGGAAAGCAATGG 0: 1
1: 0
2: 0
3: 7
4: 163
921480490_921480494 -2 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480494 1:215659347-215659369 TGACCTTAGTGAGTAAGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 99
921480490_921480497 9 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480497 1:215659358-215659380 AGTAAGGGCCGGAAAGCAATGGG 0: 1
1: 0
2: 0
3: 5
4: 80
921480490_921480492 -7 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480492 1:215659342-215659364 GTGGCTGACCTTAGTGAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 95
921480490_921480498 15 Left 921480490 1:215659326-215659348 CCTCAAGAAGGCCAGTGTGGCTG 0: 2
1: 7
2: 20
3: 76
4: 378
Right 921480498 1:215659364-215659386 GGCCGGAAAGCAATGGGATGAGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921480490 Original CRISPR CAGCCACACTGGCCTTCTTG AGG (reversed) Intronic
900336479 1:2166566-2166588 TAGCCACACTCGCCATGTTGTGG - Intronic
901140386 1:7025477-7025499 CAGCCCCTCTGGCCTTACTGGGG + Intronic
901474251 1:9478650-9478672 CAGCCACACTGGGATTCTTCAGG + Intergenic
901491308 1:9597692-9597714 CAGAGACACTGGCTTTCCTGGGG + Intronic
901754859 1:11435348-11435370 CACCCAAACTGGCCTTCTTCGGG - Intergenic
901785508 1:11622000-11622022 CAGCTACACTGTCCTTCCAGGGG + Intergenic
901933164 1:12609826-12609848 CAGCCACACTGGCCACCTCTTGG + Intronic
904064748 1:27740632-27740654 CAGCAACATTGGGCTCCTTGTGG - Intronic
904269536 1:29340634-29340656 CAGACACCCAGGCCTGCTTGAGG - Intergenic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
905354486 1:37371954-37371976 CTGCAACACTGGCCATCCTGGGG - Intergenic
905971988 1:42148832-42148854 CAGCCACCCTAGCTTCCTTGAGG - Intergenic
906141340 1:43535537-43535559 CAGCCACAGGGGCATTCTGGGGG + Intronic
906711265 1:47931650-47931672 CAGCCATACCTGCCTTCTAGAGG + Intronic
907420172 1:54341934-54341956 CAGCCACATTGGGCTTCTTTTGG - Intronic
907578923 1:55554550-55554572 CAGCCCCAGTGGACTTCTTTAGG - Intergenic
907886255 1:58594724-58594746 CAGCCACAGTGGCCTCTGTGGGG - Intergenic
908331859 1:63078968-63078990 CAGCCACACAGAGCTTCTTAAGG + Intergenic
908797894 1:67849665-67849687 CAGCTACACTACCCTTCTTTGGG - Intergenic
910238035 1:85055981-85056003 CAGACACACTGGTGTCCTTGAGG - Intronic
910606009 1:89085594-89085616 CAGACACCAGGGCCTTCTTGAGG + Intergenic
910778338 1:90899078-90899100 CAGCCACGGTGGCCTTCTTCCGG + Intergenic
912079967 1:105923692-105923714 CAGCCACATAGGCCTTCTTTTGG - Intergenic
912263366 1:108131009-108131031 CAGCCACACGGGCCTCCTGCAGG + Intergenic
912337110 1:108873616-108873638 CAGCCACAGTGGCCTTCCTCCGG + Intronic
914922003 1:151853505-151853527 CCACCACAGAGGCCTTCTTGAGG - Exonic
915298013 1:154935352-154935374 CCACCACACTGGCCTTCAAGAGG + Intronic
916708382 1:167377830-167377852 CAGCCACCAGGGCCTACTTGAGG - Intronic
916787378 1:168096428-168096450 CAGCCACTCTGGCCTGTTTGTGG - Intronic
916840757 1:168598094-168598116 CAGCCTCACTGGCACTGTTGTGG + Intergenic
917166041 1:172114313-172114335 CAGCCGCACTGGCTATCTTTTGG - Intronic
917228340 1:172808179-172808201 CAGCCACTGGGGCCTACTTGAGG - Intergenic
917894278 1:179472806-179472828 CAGCCACACCAGCTTTATTGTGG + Intronic
918120863 1:181539015-181539037 CAGCTATACTGGACTACTTGTGG + Intronic
918774422 1:188610255-188610277 CAAACACACTGGACTTATTGGGG + Intergenic
919015229 1:192024913-192024935 CAGACACAGCGGCCTGCTTGAGG - Intergenic
921310238 1:213835224-213835246 CAGCCACACTGGCTTTCTTTTGG - Intergenic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
921635063 1:217482525-217482547 CAGACACACTGGCCTCTTAGTGG - Intronic
923215277 1:231843269-231843291 CAGCCCCACTAAACTTCTTGCGG - Intronic
923223679 1:231919457-231919479 CAGGCACGCTGGCTTTCCTGTGG + Intronic
923509275 1:234635532-234635554 CAGCCACATTGGTCTCCTGGAGG + Intergenic
924206277 1:241714144-241714166 AGGCCACCCTGGCCTCCTTGAGG - Intronic
924740140 1:246790131-246790153 TGGCCACACTGCCCTTCTTTTGG - Intergenic
1063464951 10:6237022-6237044 CGGCCACACTGGCCTCCTGCAGG + Intergenic
1064437954 10:15327751-15327773 CAGACACATGGGCCTACTTGAGG + Intronic
1065160207 10:22911761-22911783 TCAACACACTGGCCTTCTTGGGG + Intergenic
1066698594 10:38101663-38101685 TAGCCACCCTGGCATTCTTTAGG + Intronic
1066994057 10:42546565-42546587 TAGCCACCCTGGCATTCTTTAGG - Intergenic
1068149690 10:53116218-53116240 CAGCCATACCAGCCTCCTTGTGG + Intergenic
1070495331 10:77016118-77016140 TAGCCGCACTTTCCTTCTTGGGG + Intronic
1070795350 10:79213118-79213140 CACTCACACTGGCCTTTATGGGG + Intronic
1071265702 10:83963005-83963027 TAGCCACCATGGCCTTCTTTTGG - Intergenic
1071427829 10:85577016-85577038 CAGCCACACTGGTCTTTTGGTGG - Intergenic
1071643953 10:87342776-87342798 CAGGGACGCTGGCCTTCTCGCGG - Intergenic
1071873074 10:89816184-89816206 CAGACAAACTGACCTTCCTGAGG - Intergenic
1072009362 10:91290220-91290242 TGGCCACACTGGCCTTCTGCAGG - Intergenic
1072173407 10:92890744-92890766 CAGCAACACTGGCCTCCTCATGG - Intronic
1073740939 10:106406181-106406203 CAGCCACACTGGCTTTCCTGTGG - Intergenic
1073834505 10:107425669-107425691 CAGCTACACTGTCCTCCTTGCGG + Intergenic
1074824754 10:117206657-117206679 TAGACACACTGGCCTTCTCTTGG + Intronic
1075005775 10:118829040-118829062 CGGCCACTCTGCCCTTCATGTGG + Intergenic
1075357757 10:121797706-121797728 TCGCCACACTGGCTTCCTTGCGG + Intronic
1075482980 10:122798183-122798205 CAGGCAACCTGGCCTTCCTGGGG - Intergenic
1077183611 11:1227046-1227068 CAGCCGCACTGGCCTCCTGGTGG + Exonic
1077223396 11:1427138-1427160 CAGCCCCACTGGCTTCCTGGGGG + Intronic
1077772119 11:5230988-5231010 CAGACACCCAGGCCTACTTGAGG - Intergenic
1078447364 11:11414407-11414429 CAGCCACACTGGACTTCTTGTGG + Intronic
1079152795 11:17915993-17916015 TGGCCACACTGGCCTTGCTGTGG + Intronic
1079410171 11:20180101-20180123 CAGACACACTGATCTCCTTGTGG + Intergenic
1079423317 11:20315805-20315827 CAGCCAAGCTGACCTTCTTATGG - Intergenic
1083152314 11:60799583-60799605 CAGCCACCATGGCTTCCTTGAGG + Intronic
1083508320 11:63182211-63182233 GAGCAACACTGGCCTTCCTCTGG + Intronic
1083859349 11:65411678-65411700 CAGGGACACTGCCCATCTTGAGG - Exonic
1083876140 11:65525255-65525277 CGGCCGCACTCACCTTCTTGCGG - Exonic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084106632 11:66984838-66984860 CAGCCACAGTGAGCATCTTGAGG - Intergenic
1084941876 11:72617338-72617360 CAGCCATGCTGGTCTTCTTAGGG + Intronic
1085929129 11:81059490-81059512 CAGCCAAACTGACCTTCTCTTGG + Intergenic
1086343340 11:85869927-85869949 CAGCTTCACTGGCCCGCTTGTGG - Intronic
1086516024 11:87614228-87614250 CAGCCACACCTGCCTTCTTTTGG + Intergenic
1087373957 11:97320043-97320065 CAAACACACTGGACTTATTGGGG + Intergenic
1089751194 11:120652458-120652480 CAGCCTCTGTGGCCTCCTTGAGG - Intronic
1089903542 11:122013092-122013114 CAAACACACTGGACTTATTGGGG + Intergenic
1090259001 11:125305350-125305372 CAACCACACTGACCTGCTTAGGG + Intronic
1091014631 11:132039038-132039060 CAGCCACACTGGTGTCCATGGGG + Intronic
1091577919 12:1756478-1756500 TAACTACACTGGCCTTCTTTTGG - Intronic
1091849844 12:3686769-3686791 GTGTCACACTGTCCTTCTTGAGG - Intronic
1091991919 12:4962304-4962326 CAGCCAGACTTGCGTTTTTGAGG + Intergenic
1091992201 12:4964411-4964433 CAGCCATTGTGCCCTTCTTGGGG + Intergenic
1092141662 12:6188129-6188151 CACACACACTGGCCCTCTAGGGG + Intergenic
1092162389 12:6322989-6323011 CAGCCCCACTGGCTATCCTGGGG - Intronic
1094084383 12:26573749-26573771 CATCCACACTGACCTTCTTTCGG - Intronic
1094478156 12:30858314-30858336 TAGACACACGGGCCTACTTGAGG - Intergenic
1097628411 12:62030145-62030167 AAGACACACTGGCATCCTTGGGG + Intronic
1097951146 12:65429415-65429437 CAACCACACTGGTCTTCTCTTGG - Intronic
1098992252 12:77076668-77076690 CAGCCACACTTGGCTCTTTGTGG + Intergenic
1099328592 12:81252038-81252060 CAGCCACATTGGTCTCTTTGAGG + Intronic
1100365723 12:93918611-93918633 GAGCCACACTGCCTTTCTCGGGG + Intergenic
1102364858 12:112323787-112323809 CAGTCAAACTGGCCTTTTTTGGG - Intronic
1102492318 12:113296781-113296803 CTTCCACAGTGGCCTCCTTGGGG + Exonic
1103072972 12:117960049-117960071 CAACCACAGTGGACTCCTTGGGG + Intronic
1103088047 12:118077175-118077197 CGGCCACACTGGTCTTCTCTCGG + Intronic
1103162794 12:118744087-118744109 CTGCCACACTGGCCTCCTCATGG - Intergenic
1103727914 12:123007887-123007909 GAGCTACGCTGGGCTTCTTGGGG - Intronic
1103941878 12:124505718-124505740 CAGCCACGCTCTCCTTCTGGGGG - Intronic
1104004324 12:124881505-124881527 CAGCCACCCTGGCTTCCTTCAGG + Intronic
1104101230 12:125612701-125612723 TAGCCACTCTGGCTTTCTTATGG + Intronic
1104919873 12:132285178-132285200 CAGCCACACTTGCCTCCTCCTGG - Intronic
1106011021 13:25823082-25823104 CAGCTACAGTGGCCTTCTGTTGG - Intronic
1107640657 13:42439961-42439983 CAGCCTCACAGGCCATCTTCAGG - Intergenic
1107769365 13:43773525-43773547 CAGCCACACTGGCCTCCTTCTGG + Intronic
1107864842 13:44693651-44693673 CAGCGACTCTGGCTTTCTGGAGG - Intergenic
1108266759 13:48717897-48717919 CCTCCACACTGGCCTAATTGTGG + Intergenic
1109302623 13:60604870-60604892 CAGCCACACTGGCCTCCTTCGGG - Intergenic
1109374030 13:61465326-61465348 CAGTCACACTGGGCTACTTGTGG + Intergenic
1109374826 13:61478622-61478644 CAGACACAAGGGCCTACTTGAGG - Intergenic
1109429881 13:62218028-62218050 TAGCTACACTGTCCTTCCTGTGG + Intergenic
1110425041 13:75357493-75357515 CAGCCACACTGGCCTCAATTTGG + Intronic
1110646091 13:77886228-77886250 TAGGCACAGTGGTCTTCTTGTGG - Intergenic
1111957069 13:94770927-94770949 CAGCCATACTAGCCTTCTTTGGG - Intergenic
1112446205 13:99466446-99466468 CAGACACTCGGGCCTACTTGAGG - Intergenic
1112454671 13:99548146-99548168 CAGCCACACAGGCTTTCTGTCGG + Intronic
1113958670 13:114113202-114113224 CAGCCACACCGGCCTCCTCCTGG + Intronic
1114382692 14:22224668-22224690 CAGACACCCAGGCTTTCTTGAGG - Intergenic
1115369426 14:32595324-32595346 CAGCCACACTGAGCTGCTTGTGG + Intronic
1115639080 14:35320574-35320596 CAGCCACACTCACCTGCATGAGG - Intergenic
1115708073 14:36018422-36018444 CATCCACACTGGTCTTCATATGG + Intergenic
1117825854 14:59702899-59702921 CAGCCACCCTGGCTTCCTTGCGG + Intronic
1119095124 14:71823039-71823061 CAGCCACACTGGCTTTCTTGGGG + Intergenic
1119215940 14:72869077-72869099 CAGCCACAGTGGCCTTCCATGGG + Intronic
1119549375 14:75497247-75497269 CAGCCACCCTGGGCCTCTGGAGG + Intergenic
1119692832 14:76690543-76690565 CAGCCTCACTGCCCTGCTGGGGG + Intergenic
1120122782 14:80701827-80701849 CAGCCACACTGGCTTCCTTGTGG + Intronic
1121825842 14:97008718-97008740 CAGCCACCCTTGCCTTCTCTGGG + Intergenic
1123438482 15:20272856-20272878 CAGCCTTCCTGGCCTTCTTGTGG - Intergenic
1123494772 15:20814589-20814611 CCTCCAAACTGCCCTTCTTGGGG - Intergenic
1123551267 15:21383682-21383704 CCTCCAAACTGCCCTTCTTGGGG - Intergenic
1124250122 15:28101541-28101563 CAGCCAAACTTGCCTTCAAGGGG + Intergenic
1124581192 15:30956611-30956633 TAGCCCCACTGGCCTTCTTTAGG - Intronic
1124875290 15:33586286-33586308 CAGCCACACTGGACTTCGGATGG + Intronic
1124897319 15:33789135-33789157 CAGCTACACTGGCCTCCTTTTGG - Intronic
1125090093 15:35780581-35780603 CAGACACAGGGGCCTTCCTGAGG + Intergenic
1126842373 15:52729723-52729745 CAGCCCCAAAGGGCTTCTTGAGG + Intergenic
1127011073 15:54629266-54629288 CAGACACTGTGGCCTACTTGAGG + Exonic
1129011361 15:72420791-72420813 CAGCCACATTGGCTTCCTTGTGG + Intergenic
1129061703 15:72865615-72865637 CAGCCAGGCTGAACTTCTTGTGG + Intergenic
1129238661 15:74239168-74239190 CAGACACACGGCCCTTCTAGAGG + Intronic
1130315774 15:82795110-82795132 CAGCCCCTCTAGCTTTCTTGTGG + Intronic
1130898958 15:88192708-88192730 CAGTCACACTGTCCTGCTTCTGG + Intronic
1131363847 15:91820385-91820407 AAGCCACACTGGACCCCTTGTGG - Intergenic
1131776236 15:95802305-95802327 CAGCCACACCAGCCTCCTTTCGG + Intergenic
1202959608 15_KI270727v1_random:110925-110947 CCTCCAAACTGCCCTTCTTGGGG - Intergenic
1132586553 16:708079-708101 CAGCCACACTGGCCTTCTTCTGG + Intronic
1133747974 16:8701895-8701917 CAGCCACACTGGCCCCCTCGTGG - Intronic
1134023738 16:10939478-10939500 CAGCCACATGGGCCTCCTTTTGG + Intronic
1134559636 16:15197211-15197233 CAGCCACACAGGTATTCTTCTGG - Intergenic
1134768195 16:16780931-16780953 CAGGCACACTGGCCCTCCTGAGG - Intergenic
1134920176 16:18108822-18108844 CAGCCACACAGGTATTCTTCTGG - Intergenic
1135659479 16:24282333-24282355 GAGTCACACTGGGCTTATTGCGG + Intronic
1137673146 16:50291122-50291144 GAGCCACACTGGCCTGGCTGTGG + Intronic
1138631542 16:58298449-58298471 CAGACACTGGGGCCTTCTTGAGG - Intronic
1139198028 16:64944017-64944039 CAGCCACACTGGCCATCTTTCGG - Exonic
1140542012 16:75764831-75764853 CAGACACATGGGCCTACTTGAGG - Intergenic
1141005123 16:80344798-80344820 CTCCCACAATGGCCTTCTTAAGG - Intergenic
1141040872 16:80671276-80671298 CAGCCACTCTGGCCTTCCTCTGG - Intronic
1143476999 17:7208501-7208523 CTGGGACACTGGCCTTCTGGTGG + Intronic
1144234236 17:13241735-13241757 CATCTACACTGGCCTTCTTCAGG - Intergenic
1144743579 17:17598183-17598205 CAGCCACACTGGCCTCTTTGAGG + Intergenic
1146594078 17:34154838-34154860 CAGCCACACTGGACTTCTGGAGG + Intronic
1146675385 17:34769788-34769810 CAGCCACAGTGACCTTCATTTGG + Intergenic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1150132053 17:62674662-62674684 CAGCCCCAGTGGGCTTCTAGAGG + Intronic
1150439656 17:65180810-65180832 CAGACACCCAGGCCTACTTGAGG - Intronic
1150939893 17:69681268-69681290 CAGACACAGGGGCCTTCTTGAGG - Intergenic
1151069816 17:71196047-71196069 CAGCCACCAGGGCCTACTTGAGG - Intergenic
1152085364 17:78214539-78214561 CAGCCACAGTGGCCTCGCTGGGG - Intronic
1152114825 17:78378969-78378991 CTTCTTCACTGGCCTTCTTGAGG + Intronic
1152144040 17:78556991-78557013 CAGCAACACAGGGCTTGTTGAGG - Intronic
1152526212 17:80889650-80889672 CACACGCACTGGCCTTCTTTAGG - Intronic
1154248991 18:12726997-12727019 CAGCCACACTGGCCTGTCTGTGG - Intergenic
1154452175 18:14487110-14487132 CCTCCAAACTGCCCTTCTTGGGG - Intergenic
1155045550 18:22100135-22100157 CAGCCACACTGGTCTCCTCATGG - Intergenic
1155051067 18:22148253-22148275 TAGAGACATTGGCCTTCTTGAGG + Intergenic
1155551826 18:26972974-26972996 CAGCTACACTGGCCTCCTTTTGG + Intronic
1155915326 18:31551757-31551779 CAGCCATACCAGCCTTCTTATGG + Intergenic
1156585044 18:38422726-38422748 CTGCCAAACTGGCCTTCTGTGGG + Intergenic
1156889542 18:42174943-42174965 CAGCAGCAATGGCCTTCATGGGG - Intergenic
1157154750 18:45254824-45254846 CAGCATCATTGGCCTCCTTGGGG - Intronic
1158109892 18:53929286-53929308 CAGGCACAGTGGCTTACTTGAGG + Intergenic
1158881353 18:61782372-61782394 CAGGGACACTGGCCTACCTGAGG - Intergenic
1159005110 18:63004326-63004348 TGGCCACACTGGCCTTCTCCAGG - Intergenic
1159549704 18:69881732-69881754 CAGCTAGACTCGCCTTCCTGGGG + Intronic
1160458902 18:79022701-79022723 CAGCCACACTGGCTTTCTCGTGG - Intergenic
1160676316 19:393260-393282 CAGCCACATGGGCCTGCTTTTGG - Intergenic
1160794917 19:940861-940883 CAGCCACAGTGGCTTTGATGAGG - Intronic
1161680996 19:5679738-5679760 CAGCCACACTTCCCTTGATGAGG + Exonic
1162377657 19:10314803-10314825 AGCCCACACTGGCTTTCTTGTGG - Intronic
1162719724 19:12655252-12655274 CAGCCACACTGAGCTCCTTGTGG + Intronic
1162820976 19:13223540-13223562 CCCCCACACTGGCCTCCTTTCGG + Intronic
1163429926 19:17261228-17261250 CAGCCACACTGGCCTCCTTCGGG + Intronic
1164741282 19:30577349-30577371 CAGCCAGCCTGGTGTTCTTGGGG + Intronic
1165034454 19:33022756-33022778 CAGCCTTCCTGGCCTTCTTGTGG - Intronic
1165324888 19:35108828-35108850 CAGCCACACCAGCCTCCCTGTGG - Intergenic
1165374369 19:35431352-35431374 CAGCCACACTGGCCTCCTTTCGG + Intergenic
1165479887 19:36056385-36056407 CAGTCACACTGGCCTGCTTTTGG + Intronic
1165890850 19:39111516-39111538 CAGCCACAGTGGCCTCCTCGTGG - Intergenic
1166054573 19:40280650-40280672 AAGCCACACAGGCCTCCGTGAGG + Intronic
1166100639 19:40569651-40569673 CAGCCAGGGTGGCCTTCCTGGGG - Exonic
1167709691 19:51102762-51102784 CAGCCACACTGGACTTCTTGGGG + Intronic
1167824691 19:51961506-51961528 CTGACACACTGGCCCTCTTTTGG - Intergenic
1168301762 19:55408733-55408755 CAGCCACACCCGCCTTCTCTGGG + Intergenic
1168313962 19:55476010-55476032 CAGCCACACTGGCTTTTCTGAGG - Intergenic
925756378 2:7135988-7136010 CAGATACACTGGCCTTATGGTGG - Intergenic
926072059 2:9904268-9904290 CAGACACAAGGGCCTACTTGAGG - Intronic
927295327 2:21446560-21446582 CAGCCACACTGACCTTCTCGAGG + Intergenic
927993321 2:27463837-27463859 CAACCACACTGGCATCCTTTTGG - Intronic
928600403 2:32898805-32898827 CAGCCACACTAAGCTCCTTGGGG - Intergenic
928634658 2:33231671-33231693 CAGCCAGGCAGGCTTTCTTGGGG - Intronic
929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG + Intergenic
930093754 2:47551185-47551207 CAGACACACTGGCTTCCTTGCGG + Intronic
930186261 2:48415178-48415200 AAACCACACTGGCCATCTGGGGG + Intergenic
930365610 2:50435783-50435805 CAGACACTGGGGCCTTCTTGAGG + Intronic
931913969 2:66932908-66932930 CAGCCACAATGGCCCTCCTTTGG - Intergenic
932296549 2:70628409-70628431 CAGACACTGTGGCCTCCTTGAGG - Intronic
932309138 2:70725875-70725897 CAGCAACACTGGCATCATTGGGG - Intronic
932808575 2:74804979-74805001 TAGCCACACCTGACTTCTTGAGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
933700893 2:85254802-85254824 CAGCCTCACTGGCCTAGATGAGG + Intronic
933856586 2:86420058-86420080 CAGCCACTCTGGTCTCCATGGGG + Intergenic
934760955 2:96856896-96856918 CAGCCACACTGGTCTTGTTTTGG - Intronic
934762758 2:96865441-96865463 GGGCCATGCTGGCCTTCTTGTGG - Exonic
935149693 2:100422587-100422609 CAGTCACTCAGGCTTTCTTGGGG + Intergenic
935890694 2:107674707-107674729 CAGTCACAGAGGCCTTGTTGAGG + Intergenic
936069024 2:109353224-109353246 CAGCTGCACTGGCCTCCTGGTGG + Intronic
936974437 2:118205027-118205049 CAGAGACACTGGCCTTCCAGAGG - Intergenic
937276966 2:120691075-120691097 CTGACACACTGGCCTCCTGGAGG - Intergenic
937358687 2:121214102-121214124 CAGCAACAATGCCCTTCTTCAGG + Intergenic
937806669 2:126152733-126152755 CAGACACTGTGGCCTACTTGAGG - Intergenic
937970696 2:127546627-127546649 CAGCCACACTGACCTGCCTCAGG + Intronic
938018468 2:127886347-127886369 CAGGGACGCTGGCCTTCTCGCGG - Intergenic
938969820 2:136421822-136421844 CAGCCACTTTGGTCTTCTTTCGG + Intergenic
941239860 2:163023878-163023900 CAGCCACAGGGACCTACTTGAGG - Intergenic
944848302 2:203690940-203690962 CAGCCACACTGAGCTCCTTGTGG + Intergenic
945337014 2:208604189-208604211 AATCCACACTGGCCTCATTGAGG + Intronic
945445583 2:209933880-209933902 CAGCCACCCTGACATTCCTGTGG + Exonic
945604121 2:211906714-211906736 CAGACACTGTGGCCTACTTGAGG - Intronic
945644996 2:212480331-212480353 CAGCCACACTGGCCTCTTTTTGG - Intronic
946114765 2:217451710-217451732 CAACCATACTTGCCTTCTCGGGG + Intronic
946472919 2:219979395-219979417 CAGCCTCACTTTCCTTTTTGGGG + Intergenic
946884358 2:224208322-224208344 CAGCAGCATTGGCCTCCTTGTGG - Intergenic
947949205 2:234133393-234133415 CAGCCCCACTGTCCTCCTTGTGG - Intergenic
948372786 2:237500856-237500878 ACGCCACACTGTCTTTCTTGTGG + Intronic
1168956805 20:1840271-1840293 CAGCCACACTGATCTCCTTGGGG - Intergenic
1168976469 20:1969748-1969770 CAGCCTCACTGACCTTCTGAGGG + Intergenic
1169005819 20:2206869-2206891 GAGCGACACTGACCTTCTTAAGG - Intergenic
1169088832 20:2844824-2844846 CAGCCACACTGGCTCTCTTTAGG - Intronic
1170340134 20:15316375-15316397 GAGCCACCCTGGCTTTCTTTTGG - Intronic
1172319283 20:33983581-33983603 CTGACACCCAGGCCTTCTTGAGG + Intergenic
1173787309 20:45803517-45803539 CAGCCACACTGGCCTCAGAGAGG + Intronic
1174098732 20:48110236-48110258 CAGCCACACCAGCTTCCTTGAGG + Intergenic
1174612816 20:51813085-51813107 CAGCCCCACTGGCCTTTTTCTGG - Intergenic
1175621268 20:60449468-60449490 CAGCCAGGCTGACCTTCTGGTGG + Intergenic
1175741805 20:61425106-61425128 GAGCCACACAGGCGGTCTTGGGG - Intronic
1176443850 21:6801190-6801212 CCTCCAAACTGCCCTTCTTGGGG + Intergenic
1176717535 21:10365799-10365821 CAGCCCCACTGGCCTTTTTCTGG - Intergenic
1178335845 21:31742385-31742407 AAGCCACTTTGGCTTTCTTGTGG + Intergenic
1178350158 21:31867115-31867137 CAGCCACACTGACCTGTGTGTGG - Intergenic
1178819221 21:35960026-35960048 CAACCACACGGGCTTTCTTTGGG + Intronic
1178952535 21:36996920-36996942 CAGGTACACTGGCTTTCTGGGGG - Intergenic
1179147058 21:38777229-38777251 CATCCACGCTGGGGTTCTTGGGG - Intergenic
1179879257 21:44286639-44286661 CAGCCATCCTGGACTTCTGGAGG + Exonic
1180239299 21:46489585-46489607 CTGCCACACTGCGCTTGTTGGGG + Intronic
1180298762 22:11018719-11018741 CAGCCCCACTGGCCTTTTTCTGG - Intergenic
1180600808 22:17014202-17014224 CAGCTCCACTGGCCTTTTTCTGG + Intergenic
1180857577 22:19058151-19058173 CAGACTCACTGGCTTTTTTGAGG - Intronic
1180960428 22:19759904-19759926 CAGCCTCACTCGCCCTCTTCCGG - Intronic
1180960962 22:19762162-19762184 CAGGCACACAGGCCCTCCTGAGG + Intronic
1181165061 22:20978857-20978879 CATCCACACTGGTCTCTTTGGGG + Intronic
1181276410 22:21689881-21689903 CATCCACTCTGGCCTTGTAGTGG - Intronic
1181294370 22:21823611-21823633 TAGCCACAGTGGTCTTCTTAGGG - Intronic
1181457513 22:23068123-23068145 CAGCCACACTGGTCTTCTCTGGG + Intronic
1181609779 22:24004652-24004674 CAGGCACCCTGGCTTCCTTGTGG - Intergenic
1181811702 22:25407037-25407059 CAGCCACAGTGGCATCCCTGTGG + Intergenic
1181908310 22:26217372-26217394 CGGCCACACTGATCTTCTTGTGG + Intronic
1183018352 22:35008072-35008094 CAGCCACCCTGGGTTTCTCGGGG + Intergenic
1183108241 22:35629907-35629929 CAGCCAAACTGGTCTTCTCTGGG - Intronic
1183328522 22:37207153-37207175 CGGCCGCACTGGGCTTCTTCGGG - Exonic
1185246453 22:49775715-49775737 CAGGCACACGGGGCATCTTGGGG + Exonic
949907432 3:8870406-8870428 CAGCCACACAGCCCTTCTTACGG - Intronic
950718114 3:14863965-14863987 CAGCCACACTGGCTTCCATTTGG - Intronic
951189041 3:19748095-19748117 CAGCCCCACTGTTCTTCTTGAGG + Intergenic
951620606 3:24597902-24597924 GAGCCACACTGACTTTCTTATGG + Intergenic
952040958 3:29261273-29261295 CAACCACACTGACCTCCTTGTGG - Intergenic
953799241 3:46009248-46009270 CGGCCACACTGGCCTCCTTGTGG - Intergenic
953905508 3:46866474-46866496 CGGCCACGCCGGCCTTCTTCTGG + Intronic
953935425 3:47037653-47037675 AAGCCACACTCACCTTCATGGGG + Exonic
954575813 3:51675561-51675583 CAGCCACACAGAGCTTCCTGAGG - Intronic
954618870 3:51984469-51984491 CAGCCCCAGTGGGCTTCTGGAGG - Intronic
955775995 3:62433594-62433616 CATCCGCACTGGCTTTCTTCAGG - Intronic
956453673 3:69399590-69399612 GAGCCATACTGGTCTTCTTTTGG + Intronic
957151793 3:76495953-76495975 CAGCCATATTGTACTTCTTGAGG + Intronic
959090656 3:101899318-101899340 CAGCAAGACTGGCATCCTTGGGG + Intergenic
959587948 3:108042712-108042734 CAGCTTCACTGTCCTTCGTGTGG - Intergenic
960769405 3:121175891-121175913 CAGCTACACTAGCTTTCTTTTGG - Intronic
961049537 3:123734726-123734748 CGGCCACACTGGCGTCCTTCTGG + Intronic
961741152 3:129033899-129033921 CAGCCACAGTGGCCTCCTGGCGG - Intronic
961979479 3:131061879-131061901 CCACCACAGTGGCCTTCTTGAGG + Intronic
962322561 3:134404039-134404061 CAGCCACACTGCCCTCCTTACGG - Intergenic
962623637 3:137203189-137203211 CAGCCACACTGGCCTGCTTTTGG + Intergenic
963236826 3:142963981-142964003 CAGCCACGCGGGCGTTCTGGAGG + Intergenic
963300049 3:143587508-143587530 CAGCCATGCTGGCCTCCTTGTGG - Intronic
963924454 3:150936817-150936839 TAGCCACATTGGCCTTCTTTCGG + Intronic
964602699 3:158519566-158519588 TTGCCAAACTGGCCTTCTTCAGG - Intronic
965006863 3:163038359-163038381 CAGCCACCCTGGATTTCTCGTGG + Intergenic
965866345 3:173208599-173208621 CAATAACACTGGCCTTCTTGTGG + Intergenic
966518455 3:180846304-180846326 CAGCCACATTGCCCTCTTTGGGG + Intronic
966878567 3:184337002-184337024 CAGTCACACAGGCCTTGGTGTGG + Intronic
968752392 4:2396797-2396819 CAGCCACCCGGGGCTCCTTGCGG - Intronic
968957832 4:3728159-3728181 CACCCCCACTGGCCTTCTTGTGG - Intergenic
969074937 4:4570486-4570508 CAGCTACATTGGCCTGCTGGAGG - Intergenic
969102137 4:4777219-4777241 CAGCCACACTGGCCTTCAAGTGG - Intergenic
969530677 4:7728632-7728654 CAGGCACACTGCCCTTATTTAGG + Intronic
970039753 4:11782679-11782701 CAGACACAGGGGCCTACTTGAGG + Intergenic
970344385 4:15139279-15139301 GAGCTACAATGGCCTTCTTTTGG - Intergenic
970840335 4:20461349-20461371 CAGCCACATTGGCCTCCTTAGGG - Intronic
971029592 4:22621815-22621837 CAGCTACACTGGCCTCCTTTTGG + Intergenic
971772491 4:30915355-30915377 TAGCCACAGTGGCCTTCTAAAGG + Intronic
971826207 4:31626260-31626282 AAGCCACAGTGGCATTCTTGTGG + Intergenic
972615710 4:40696003-40696025 CAGCCACAGTGGTCCTCTTTTGG + Intergenic
972703286 4:41515122-41515144 CAGCCTCACTTGCCGTCCTGAGG - Intronic
973193751 4:47416252-47416274 CAGCCACACAGGCCTTATTTTGG - Intronic
973392377 4:49567302-49567324 CAGGCACACTGCCCTGCTAGAGG - Intergenic
974154756 4:58056502-58056524 CAGACACACTGGCATCCTTACGG + Intergenic
975733496 4:77359636-77359658 CAGCCATCCTGTCCTTCCTGAGG + Intronic
976640219 4:87329926-87329948 CAGACACAGGGGCCTACTTGAGG - Intergenic
977786351 4:101039125-101039147 TAGCCATACAGGCCTCCTTGTGG + Intronic
978352037 4:107830040-107830062 CAGACACAGGGGCCTACTTGAGG - Intronic
979883251 4:125988864-125988886 AAGCCCCAGTGGCCTACTTGAGG + Intergenic
984329645 4:178298243-178298265 CAGAAACAGAGGCCTTCTTGAGG + Intergenic
984720625 4:182969803-182969825 CTGCCACACCCGCCTTCTAGGGG + Intergenic
986268614 5:6211880-6211902 GAGACACACTGGGCTTCTCGAGG - Intergenic
986748636 5:10765283-10765305 TGGCCACACTGGCCTTTCTGAGG + Intergenic
987020338 5:13863890-13863912 CAGCCACATGGGCCTTCTTCTGG + Intronic
989451382 5:41590139-41590161 CATCCTCACTGTCATTCTTGTGG - Intergenic
990106548 5:52270598-52270620 CAGACACAGTGGTCTACTTGAGG + Intergenic
990122714 5:52475295-52475317 AAACCACATTGGCCTTCTTTTGG - Intergenic
990295051 5:54392999-54393021 CAAACACTGTGGCCTTCTTGAGG - Intergenic
990399451 5:55423452-55423474 CAGCCACACTGGCCTCTTGCTGG - Intronic
990599885 5:57347571-57347593 CAGCCACACTGGCTTTACAGTGG + Intergenic
991002713 5:61798527-61798549 CACCTGCACTGGCCTTCTGGTGG - Intergenic
991585456 5:68197080-68197102 CAGCCATGCTGGTCTTCTTTCGG - Intronic
993246575 5:85459638-85459660 CAGCCAGACTGTCTTCCTTGTGG - Intergenic
995090390 5:108168747-108168769 GATCCACACTGGTTTTCTTGGGG - Intronic
995155315 5:108904457-108904479 CAGCTACACTGGCTTCCTTTTGG - Intronic
995816432 5:116174269-116174291 CTGCCACACTGGCCTCCTTCTGG - Intronic
997237328 5:132280405-132280427 CAGCCACACTGGACTTGTTCTGG + Intronic
997725427 5:136116485-136116507 CCTCCACACTGGCCTTCTTTTGG - Intergenic
997996636 5:138591805-138591827 CAGCAACACGGGCCTTCTTTCGG + Intergenic
998398211 5:141833325-141833347 CAGCCACATGGGCTTTCTTCTGG - Intergenic
999182682 5:149681135-149681157 CACCCACTCTTGCATTCTTGGGG + Intergenic
999291311 5:150428232-150428254 CAGCAATGCTGGCCTCCTTGTGG - Intergenic
1000610348 5:163366901-163366923 CACTCACACTGGCCATTTTGTGG + Intergenic
1001201703 5:169723595-169723617 CAACCACACTGGACTTGCTGTGG + Intronic
1001860809 5:175053170-175053192 CAGGCAAACTTGCCTGCTTGAGG + Intergenic
1002696809 5:181097784-181097806 CACCCACATTGGCCCTCTTTGGG + Intergenic
1002697813 5:181101589-181101611 CACCCACATTGGCCCTCTTTGGG - Intergenic
1002704260 5:181149450-181149472 CAGCCCCACTGGCCATCTGGGGG + Intergenic
1002707787 5:181174361-181174383 CACCCACATTGGCCCTCTTTGGG + Intergenic
1003276244 6:4655699-4655721 CAGCCACGCTGGCCTCCCCGAGG - Intergenic
1003664841 6:8101430-8101452 GAGCCAAAGTGGCCTTCTTTTGG - Intronic
1004108367 6:12688285-12688307 CAAGCACTCTGGCCTACTTGAGG + Intergenic
1004291446 6:14371030-14371052 CAGTCACACTGCCTTTCTTTGGG - Intergenic
1005102363 6:22186305-22186327 CTGCCAAACTAGCTTTCTTGAGG - Intergenic
1006509355 6:34513529-34513551 CACCCACACTGTCCCTCCTGGGG + Intronic
1006515753 6:34544716-34544738 CAGCCAGCCTGGCTTCCTTGGGG - Intronic
1006604724 6:35247985-35248007 GAGCCACACTGGCCTTCTGGAGG - Intronic
1006643689 6:35501948-35501970 CAGCCACACTGGTCACCTGGTGG + Intronic
1008351195 6:50492345-50492367 TAGCCAGGCTGGCCTTCTCGAGG + Intergenic
1008539008 6:52530259-52530281 CTGCCACCCTGGCGTCCTTGAGG - Intronic
1010023272 6:71186481-71186503 CAGACACAAAGGCCTACTTGAGG + Intergenic
1011470114 6:87700868-87700890 CAGCCAAAGTGGCGTTCTTGTGG + Intronic
1012179015 6:96127197-96127219 CAGCCACTGGGGCCTACTTGAGG - Intronic
1013008802 6:106101064-106101086 CAGGCACAGTGGCATTTTTGTGG + Intronic
1013820309 6:114146565-114146587 CAGCCTCCCTGCCCTTCTAGGGG - Intronic
1014075454 6:117229876-117229898 CAGACACAGGGGCCTACTTGAGG - Intergenic
1014335385 6:120127229-120127251 CAGACACTGGGGCCTTCTTGAGG - Intergenic
1015474031 6:133638838-133638860 CAGCCACTGGGGCCTACTTGAGG - Intergenic
1015743389 6:136483339-136483361 CAGACACCAGGGCCTTCTTGAGG + Intronic
1016252140 6:142056481-142056503 CAGCCACACTGGCCTCCTTTTGG + Intergenic
1016333009 6:142973601-142973623 CAGCCACACAAGCTTTCTTTTGG - Intergenic
1016578340 6:145597734-145597756 CAGACACTGGGGCCTTCTTGAGG - Intronic
1017950805 6:159133148-159133170 CAGCCACATTGACTTTCCTGGGG - Intergenic
1018333593 6:162760608-162760630 CAGCCACACTGACCTCCGTGTGG - Intronic
1018888160 6:167959114-167959136 GAGCCACACTGTCTTCCTTGTGG + Intronic
1019276042 7:176499-176521 CAGCCTATCTGGCCTTCTTCAGG + Intergenic
1019568018 7:1694264-1694286 AACCCACACTGGCCTCCCTGCGG + Exonic
1019772404 7:2891800-2891822 CAGCCACACTGGCCCCCTGTTGG - Intergenic
1020817003 7:12917837-12917859 CAGACACTGTGGCCTACTTGAGG - Intergenic
1021523181 7:21556685-21556707 CAGACACTGTGGCCTTCTTGAGG - Intronic
1021722557 7:23518194-23518216 CAGGCACACTGGCTTAATTGGGG - Intronic
1021899931 7:25275233-25275255 CTGGCACACTGGCGTGCTTGAGG - Intergenic
1022455667 7:30556212-30556234 TTGCCACACTGGGGTTCTTGAGG + Intergenic
1022872815 7:34497287-34497309 CTGCCACACTGGCCTGAATGTGG + Intergenic
1023140838 7:37100760-37100782 CACACACACTGTCCTTCGTGTGG - Intronic
1023446874 7:40240973-40240995 CAGTGACACTGCCCTTCTTTTGG - Intronic
1024262759 7:47584115-47584137 CGGCCACACTGCCCTTGTTGGGG + Intergenic
1027476602 7:78639769-78639791 CAGTCACACTGGCCTGAATGGGG - Intronic
1027692207 7:81361903-81361925 CAGCCACACTGACCTCCTTTGGG - Intergenic
1028323639 7:89494917-89494939 CAGACACTGTGGCCTACTTGAGG + Intergenic
1028510594 7:91621088-91621110 CAGCCACACTTACCCTCTTTAGG + Intergenic
1029275713 7:99403004-99403026 CAGCTACACTGGCCCCCTTCTGG + Intronic
1029276272 7:99406649-99406671 CAGCCACCCTTGCATACTTGGGG - Intronic
1029648585 7:101874633-101874655 GGGCCACACTGGCCAGCTTGAGG - Intronic
1031423822 7:121581802-121581824 CACCCACACTGGCCATCTCTAGG - Intergenic
1031602689 7:123730960-123730982 CAGACACCCAGGCCTACTTGAGG - Intronic
1033738853 7:144252374-144252396 CACCCGCAGTGGCCTTCTGGAGG - Intergenic
1033744194 7:144298580-144298602 CACCCGCAGTGGCCTTCTGGAGG + Intergenic
1034742573 7:153491945-153491967 GAACCACACTGGCCTTCTTTTGG - Intergenic
1034967693 7:155401553-155401575 CAGCCACTCTCCCTTTCTTGGGG - Intergenic
1037300948 8:17451376-17451398 CAGCCCCTGGGGCCTTCTTGAGG - Intergenic
1037605124 8:20431786-20431808 CAGCCACACTGGCCTTCTTCTGG + Intergenic
1038002188 8:23401738-23401760 CTTCCACACTGGCCATCTAGAGG + Intronic
1038298299 8:26317171-26317193 CAGCCACAGGAGCTTTCTTGAGG + Intronic
1039175296 8:34797473-34797495 CAGCCACATTGGTCTCTTTGTGG - Intergenic
1039398834 8:37250396-37250418 TAGCCCTACTGGCTTTCTTGTGG - Intergenic
1039913889 8:41845509-41845531 CAGTCCCATTGGCCTCCTTGAGG - Intronic
1040285527 8:46098660-46098682 CACCCACACAGGCCTGCATGAGG - Intergenic
1040318550 8:46277524-46277546 CATCCACACAGGCCTGCCTGGGG + Intergenic
1040877408 8:52167772-52167794 CACCCACACTGGTGTTCCTGGGG - Intronic
1040935652 8:52779070-52779092 CAGACACTGGGGCCTTCTTGAGG - Intergenic
1041934480 8:63320810-63320832 CAAACACACTGGACTTATTGGGG + Intergenic
1042242038 8:66673795-66673817 CAGCCACACTGGCCTCCTTGTGG + Intronic
1043427745 8:80165347-80165369 CAGACACACTGGCATTTTTATGG + Intronic
1043784070 8:84374688-84374710 CACCCACTATGGCCTACTTGAGG + Intronic
1044025443 8:87165563-87165585 CAGCCACCCTTGCTTTCTTTTGG + Intronic
1044234312 8:89812734-89812756 CAATCACACTGGCCTCCTTTTGG + Intergenic
1045239127 8:100383383-100383405 GAGCCACAGCAGCCTTCTTGAGG - Intronic
1045695886 8:104808416-104808438 CATCCACACTTGTCTTCTTAGGG - Intronic
1045935874 8:107678132-107678154 CAGCCACACTAGCCTTCTTGTGG - Intergenic
1046444835 8:114304618-114304640 CAGACACAGAGGCCTGCTTGAGG + Intergenic
1046578128 8:116057540-116057562 CAGGGAGACTGGTCTTCTTGAGG + Intergenic
1047025209 8:120816177-120816199 CAGCCACATTGACCTCCTTTGGG - Intergenic
1047083081 8:121485948-121485970 CAGCCACTCTAGCCTTCAGGAGG - Intergenic
1047885353 8:129244308-129244330 CAGCCACACTGGACTTTTGTCGG + Intergenic
1048006854 8:130426590-130426612 CAGCCACACTGGCTTCCTTGAGG + Intronic
1048236046 8:132691839-132691861 CAGCCACATGGGCCTTCCTCTGG - Intronic
1048534321 8:135278177-135278199 CAGCCACTCTGTCCTTCCTCTGG + Intergenic
1048716263 8:137273699-137273721 CAGCCACACTTGCCTTTTTTGGG - Intergenic
1049912689 9:284922-284944 CAGACACTGTGGCCTACTTGTGG + Intronic
1054750485 9:68899928-68899950 CAGACACAAGGGCCTACTTGAGG - Intronic
1055003532 9:71480853-71480875 CAGCTACACTGAACTTCTTCTGG + Intergenic
1056397701 9:86196592-86196614 CAGCCATACTGGACTACTGGGGG - Intergenic
1057336438 9:94159275-94159297 AAGGGACACTGGCCTTATTGAGG + Intergenic
1057454707 9:95197712-95197734 CAGCACCACTGGCCTTCCTCAGG - Intronic
1057719264 9:97518958-97518980 CAGCCACAGTGAACATCTTGAGG - Intronic
1059877403 9:118650347-118650369 CAGCCACACAGGTCTCCTTTTGG - Intergenic
1060035574 9:120252766-120252788 CAGCCACACTGGCATTCTGTTGG - Intergenic
1060143155 9:121227806-121227828 CAGCCACACTGGCCTTTGCTTGG - Intronic
1060470211 9:123942422-123942444 CAGCCACGGAGGCCTCCTTGAGG + Intergenic
1060498481 9:124134941-124134963 CAGGCACACAGGACTCCTTGGGG - Intergenic
1061300069 9:129699012-129699034 CAGGCACAGCGGCCTTCCTGTGG - Intronic
1203525350 Un_GL000213v1:83337-83359 CCTCCAAACTGCCCTTCTTGGGG - Intergenic
1185744903 X:2564751-2564773 CTGCCACATTTTCCTTCTTGGGG + Intergenic
1189351436 X:40278715-40278737 CAGCCCCATTTTCCTTCTTGTGG - Intergenic
1191695468 X:63985621-63985643 CACGCACACTGGCATTCTGGTGG - Intergenic
1191759294 X:64629403-64629425 CAAACACACTGGACTTATTGGGG + Intergenic
1192502776 X:71664512-71664534 CAGCCACACTGGCCCTCCGAGGG - Intergenic
1192529109 X:71871016-71871038 CAGCCACACTGGCCCTCCCAGGG - Intergenic
1192715610 X:73638689-73638711 CAGACACAGAGGCCTACTTGAGG - Intronic
1192727987 X:73772390-73772412 CAGCCACACTAACCTTCTTAAGG + Intergenic
1193662957 X:84279382-84279404 CAGCCACAGGGGCCTACTTGAGG - Intergenic
1194912568 X:99664838-99664860 CAGACACAGGGGCCTACTTGAGG - Intergenic
1195316915 X:103688010-103688032 CAAGCACACTGACCTTCTTCAGG + Intronic
1196022095 X:111001107-111001129 TAGCCACACTAGGCTTCCTGTGG - Intronic
1196683249 X:118490010-118490032 CTACCACACAGGCCTCCTTGAGG - Intergenic
1196683616 X:118493325-118493347 CAGCCACACTGGCCTTTTTTTGG + Intergenic
1198011447 X:132559796-132559818 CAGACACTGTGGCCTACTTGAGG - Intergenic
1198068441 X:133123376-133123398 CAGACACCTGGGCCTTCTTGAGG - Intergenic
1199203364 X:145119766-145119788 CATCCACACTGAACTACTTGTGG - Intergenic
1200098329 X:153674426-153674448 CGGCCACACTGGCCTCCTGACGG + Intronic
1201667324 Y:16473259-16473281 CAGCCTCACTGGACTTGTTGAGG + Intergenic