ID: 921480888

View in Genome Browser
Species Human (GRCh38)
Location 1:215663509-215663531
Sequence CACGCTACACACACCAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921480888_921480891 -1 Left 921480888 1:215663509-215663531 CCGTGGTTGGTGTGTGTAGCGTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 921480891 1:215663531-215663553 GCTAGGGCAGTTCTTGCTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
921480888_921480892 3 Left 921480888 1:215663509-215663531 CCGTGGTTGGTGTGTGTAGCGTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 921480892 1:215663535-215663557 GGGCAGTTCTTGCTTCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921480888 Original CRISPR CACGCTACACACACCAACCA CGG (reversed) Intronic
900726980 1:4222970-4222992 CAGGCTACACACACCTTCCTGGG - Intergenic
903098687 1:21007762-21007784 CATAGTACACACAACAACCAAGG + Intronic
904328185 1:29740958-29740980 CACTCTACCCTCACCAGCCAGGG - Intergenic
904367576 1:30024557-30024579 CAGTCTTCACACCCCAACCATGG - Intergenic
916238257 1:162612547-162612569 AATGCTATACATACCAACCATGG + Intergenic
917883281 1:179360376-179360398 CACGCCACACACTCCAGCCTGGG - Intergenic
921480888 1:215663509-215663531 CACGCTACACACACCAACCACGG - Intronic
1070663544 10:78327830-78327852 AATACTACACACACCAACCAGGG - Intergenic
1073096034 10:100980267-100980289 TACGCTACACACACCTTACAGGG + Exonic
1075801207 10:125154665-125154687 CAGGCTTCAGACACCAACAATGG + Intronic
1081573099 11:44303549-44303571 CACCCTACACACCCCAGCCTTGG + Intronic
1086591213 11:88516345-88516367 CAAGATACACACAGGAACCAAGG + Intronic
1088322578 11:108568885-108568907 CAGGCTTCACTCACCACCCATGG + Intronic
1089109916 11:116047212-116047234 CACGCTGCACACAGCAATCTGGG + Intergenic
1089662871 11:119996954-119996976 CACCCAACACACAGCAAGCAGGG + Intergenic
1093705643 12:22272376-22272398 CAAACTGCCCACACCAACCAAGG + Intronic
1097311458 12:58123395-58123417 CACGCTCCACTCAGCAACCTTGG + Intergenic
1099159845 12:79227376-79227398 CATGCTTTACAGACCAACCATGG - Intronic
1100036929 12:90263215-90263237 CACGGTTCCCACCCCAACCATGG + Intergenic
1106255003 13:28014226-28014248 CACGCCACACACTCCAGCCTGGG + Intronic
1117269171 14:54123954-54123976 CACCCTGCATCCACCAACCATGG + Intergenic
1119284493 14:73441491-73441513 CACGCCACACACTCCAGCCTGGG + Intronic
1121197183 14:92084502-92084524 GATGCTACACACAAAAACCAAGG + Intronic
1132701426 16:1223815-1223837 CATGCTCCACAAACTAACCAGGG + Intronic
1132945594 16:2530053-2530075 CACGCTGCACACCCCAACTCAGG - Exonic
1133102621 16:3488385-3488407 CTCCCTGCACACACCACCCAAGG + Intergenic
1136031869 16:27509231-27509253 CAAGCTACACACAGCAACAGCGG - Intronic
1137371284 16:47908273-47908295 CATGCTACACACAGCAACATGGG - Intergenic
1138006274 16:53340772-53340794 CACACTACACACTCCAGCCTGGG + Intergenic
1138007964 16:53355205-53355227 CAGGCCACAGACACCCACCAGGG - Intergenic
1140294973 16:73700176-73700198 CACGCCACACACTCCAACCTGGG + Intergenic
1142188694 16:88706997-88707019 CTCGGTACACACACAAACCCAGG - Intronic
1147188778 17:38726817-38726839 CACCCCACCCCCACCAACCAGGG + Exonic
1147488050 17:40837514-40837536 CACTACACACACACCAGCCAGGG + Intergenic
1152013263 17:77734081-77734103 CACCCTACCCGCACCATCCAGGG + Intergenic
1152837178 17:82540987-82541009 CACGCCACACACACCCACTGTGG - Intronic
1160586835 18:79917788-79917810 CACTGTAATCACACCAACCAGGG + Intronic
1161887110 19:7005495-7005517 CAGGCTCCACACGCCCACCAGGG + Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
925296222 2:2779375-2779397 CACTCTGCACACAGCAGCCAGGG + Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
929245029 2:39692322-39692344 CTCACTACACACACCCACAAAGG + Intronic
931753447 2:65350800-65350822 CACGTTACAGACATAAACCAAGG + Intronic
932525107 2:72457444-72457466 CACGCTTAACCCACAAACCAAGG + Intronic
934689585 2:96348004-96348026 TATGCTACACACATCACCCACGG - Intronic
945894179 2:215463613-215463635 CAAGCAACAGAAACCAACCAGGG - Intergenic
947017256 2:225634734-225634756 CACTTTACACACCCAAACCATGG + Intronic
948130622 2:235597918-235597940 CACGCTCCACACAGGAAACACGG - Intronic
948130630 2:235597982-235598004 CACGCTCCACACAGGAAACACGG - Intronic
1169446435 20:5675723-5675745 CACACTGCACACTCCAACCCGGG - Intergenic
1173986776 20:47267614-47267636 CACTCTCCACACAGCAGCCAGGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178140141 21:29673342-29673364 CAAGCCACACACACCCACAAAGG - Intronic
1179131724 21:38643552-38643574 CAAGCTACACACACAAACTCAGG + Intronic
1183315281 22:37133653-37133675 CACGCTCCACACAGCAGCCAGGG + Intronic
1185252570 22:49812746-49812768 CACTGTACACAGACGAACCAAGG + Intronic
1185340417 22:50288436-50288458 CACGCCTCAGACACCAACCCAGG + Intronic
952543570 3:34395202-34395224 CAGGCTATGCACACCATCCAGGG - Intergenic
954361129 3:50123410-50123432 CATGCTTCACACACCAACCAGGG - Intergenic
962557507 3:136570565-136570587 CACGTTACACACACGCATCAAGG + Intronic
964325029 3:155535886-155535908 CACACTAAACAAAACAACCAAGG + Intronic
966656253 3:182361598-182361620 CACGCCACACACTCCAGCCTGGG + Intergenic
968487355 4:870102-870124 CACACGGCACACACCACCCACGG + Intronic
969266416 4:6066906-6066928 CACCCCACACACACCTGCCATGG + Intronic
972659038 4:41095965-41095987 CACGCTCCATACCCCAGCCACGG + Intronic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG + Intergenic
979393148 4:120151224-120151246 CACATTACACACACCAAGAAAGG - Intergenic
979455762 4:120923807-120923829 CAGACTACACACACACACCATGG + Intergenic
985544042 5:500430-500452 CAGGAAACACACACCAAGCACGG + Intronic
997404512 5:133634243-133634265 ATCCCTACACACACCAACAAAGG - Intergenic
999973094 5:156884433-156884455 CAAGCTCCACACACCAGACAAGG + Intergenic
1009953255 6:70420923-70420945 CACGCCACACACTCCAGCCTGGG - Intronic
1012455216 6:99395848-99395870 CTCGCTACAAACATCAACAAAGG + Intergenic
1015565705 6:134568306-134568328 CACCCTTTACACACCAATCAGGG + Intergenic
1019073990 6:169372142-169372164 CACACCACACACACCACACACGG + Intergenic
1019074009 6:169372333-169372355 CACACCACACACACCACACACGG + Intergenic
1020007143 7:4789055-4789077 CCCGCCACACCCACCATCCACGG + Intronic
1020192572 7:6011322-6011344 CACGCTACACCCACCAGCTTTGG - Intronic
1023388277 7:39682408-39682430 CATTCTCTACACACCAACCAGGG + Intronic
1042317126 8:67436070-67436092 CACCCCACCCCCACCAACCAGGG + Intronic
1045113946 8:98961981-98962003 CTAGCTTCACACATCAACCAAGG - Intergenic
1049815760 8:144598630-144598652 CACACCACACACAAGAACCAAGG + Intronic
1053504448 9:38629689-38629711 CACACTCCACACACACACCATGG + Intergenic
1054925916 9:70588649-70588671 CATGCTTCACAAACCAACCTGGG + Intronic
1060197284 9:121631925-121631947 GTCTCTCCACACACCAACCAGGG - Intronic
1188060062 X:25590338-25590360 CACCCTACCCCCACCAACCAAGG - Intergenic
1188574639 X:31632124-31632146 CCCGCCACACACACACACCATGG + Intronic
1193487278 X:82102364-82102386 AACTCTGCACCCACCAACCAGGG - Intergenic
1198304280 X:135365415-135365437 CACCCCACACACACATACCAAGG + Intergenic
1199943390 X:152646876-152646898 CACCCTACACACACCAAGGATGG + Intronic
1200144573 X:153920093-153920115 CACGCTAACCACAGCAGCCAGGG + Intronic