ID: 921484706

View in Genome Browser
Species Human (GRCh38)
Location 1:215702447-215702469
Sequence CAGGTACACCAATTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1607
Summary {0: 4, 1: 191, 2: 381, 3: 463, 4: 568}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921484699_921484706 22 Left 921484699 1:215702402-215702424 CCTGAAGTGTGTTTTCCAACTTG 0: 381
1: 1737
2: 6299
3: 2252
4: 1144
Right 921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG 0: 4
1: 191
2: 381
3: 463
4: 568
921484701_921484706 7 Left 921484701 1:215702417-215702439 CCAACTTGGTTCCATTCTCCTTG 0: 60
1: 1251
2: 2875
3: 4380
4: 1996
Right 921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG 0: 4
1: 191
2: 381
3: 463
4: 568
921484702_921484706 -4 Left 921484702 1:215702428-215702450 CCATTCTCCTTGCCATTTTCAGG 0: 1
1: 3
2: 113
3: 1463
4: 3573
Right 921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG 0: 4
1: 191
2: 381
3: 463
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921484706 Original CRISPR CAGGTACACCAATTAAATGT AGG Intronic
901335634 1:8446610-8446632 CAGGCACACCAATCAAACGTAGG + Intronic
902141436 1:14360067-14360089 CAGGTACACCAATCAAACATAGG + Intergenic
903566760 1:24273391-24273413 CAGGTACACCAATCAAATGTAGG + Intergenic
905355341 1:37379668-37379690 CAGGTACACCATTCAAATGTCGG + Intergenic
905625727 1:39489844-39489866 CAGGTACAGCAATCAGATGTGGG - Intergenic
906558011 1:46729854-46729876 CAGGTACACCAATCAAACATAGG - Intergenic
906586934 1:46986397-46986419 CAGGTACACCAATCAAACATAGG - Intergenic
906739810 1:48171941-48171963 CAGGTACACCAATCAAACATAGG + Intergenic
906753087 1:48284057-48284079 CAGGTACACCAATCAAATGTAGG + Intergenic
906881948 1:49601255-49601277 CAGGAACACCAATCAAATGCAGG + Intronic
906894228 1:49753696-49753718 CAGGTATGCCAATCAAATGTAGG + Intronic
906900986 1:49836204-49836226 CAGGTATACCAATCAAACATAGG + Intronic
907015341 1:51006739-51006761 CAGGTACACCAATCAAACGTAGG - Intergenic
907565793 1:55432082-55432104 CAGGTACACCAGTCAATCGTAGG - Intergenic
907953704 1:59208006-59208028 CAGGTACACCAACCAAAGGTAGG - Intergenic
908584469 1:65553343-65553365 CAGGTACACCAATCAAACATAGG + Intronic
908593025 1:65653487-65653509 CAGATACATTAATCAAATGTAGG - Intergenic
908598121 1:65710171-65710193 CAGGTACACCAATCAATTGTAGG + Intergenic
908969323 1:69807925-69807947 CAGGTACACCAATCAAATGAAGG + Intronic
909211672 1:72831977-72831999 CAGATACTCCAATGAATTGTAGG - Intergenic
909276170 1:73689669-73689691 CAGGTACACCAATCAATTGTAGG + Intergenic
909384386 1:75038170-75038192 CAGGTACACCAATAAAATATAGG - Intergenic
909396868 1:75180318-75180340 CAGGTACACCAATCAAACATAGG + Intergenic
909415822 1:75404212-75404234 CAGATACACCAATCAAACGTAGG - Intronic
909536271 1:76740272-76740294 TAGGTACACCAATTGAACGTAGG + Intergenic
909570831 1:77108719-77108741 CAGGTACACCAATCAAATGTAGG + Intronic
909672544 1:78204911-78204933 CATGTACACCAATCAAATGTAGG - Intergenic
909689991 1:78396864-78396886 CAGGTACACCAATCAAACGTAGG + Intronic
910331156 1:86073486-86073508 TAGGTACACCAATCAAACGTAGG - Intronic
910618709 1:89229392-89229414 CAGGTACACCAATCAAACGTAGG + Intergenic
910627070 1:89318120-89318142 CAGGGACCCCAATCAATTGTAGG - Intergenic
910799686 1:91132743-91132765 CGGGTACACCAATCAAACGTAGG - Intergenic
910805587 1:91187315-91187337 CAGGTACACCAATCAAACATAGG + Intergenic
910912680 1:92254282-92254304 CAGGTACACCAGTCAAACATAGG - Intronic
911270808 1:95798739-95798761 CAGGAACACCAATCATATGTAGG - Intergenic
911691894 1:100844267-100844289 CAGGTACACCAATCAAATGTGGG + Intergenic
911938429 1:104010800-104010822 CAGGTATACCAATTAATCATAGG + Intergenic
911982906 1:104587882-104587904 CAGGTACACCTATCAAACGTAGG - Intergenic
912133199 1:106627389-106627411 CAGGAACACCAATCAAATGTAGG + Intergenic
912150663 1:106854763-106854785 CAGATACACTAATCAAACGTAGG - Intergenic
912235486 1:107845813-107845835 CAGGTACACCAATCAAATGTAGG - Intronic
912270876 1:108208055-108208077 CAGGTACACCAATCAAATGTAGG + Intergenic
912676056 1:111681714-111681736 CAGGTATACCAATCAATCGTAGG - Intronic
913020894 1:114788945-114788967 CAGGTACCCCAATCAATCGTAGG + Intergenic
913036144 1:114968306-114968328 CAGGTACACCAATCAAATGTTGG + Intronic
913078122 1:115358837-115358859 CAGGTACACCAATCAAATGTAGG - Intergenic
913108508 1:115638096-115638118 CAGGTACAACAATCAAACGTAGG + Intergenic
913507774 1:119534020-119534042 CAGGTCCACAAATAACATGTTGG + Intergenic
913942886 1:125124447-125124469 CAGGTACACCAATCAGACGTAGG - Intergenic
913972912 1:143429508-143429530 CAGGTACACCAATTAATCTTAGG + Intergenic
914067296 1:144255115-144255137 CAGGTACACCAATTAATCTTAGG + Intergenic
914111857 1:144711239-144711261 CAGGTACACCAATTAATCTTAGG - Intergenic
914399563 1:147305336-147305358 CAGGTACACCAATCAATCGTAGG - Intergenic
914404762 1:147359478-147359500 CAGGTACACCAATCAATTGTAGG - Intergenic
914458203 1:147856360-147856382 CAGGTATACCAATCAAACATAGG - Intergenic
914966986 1:152268773-152268795 CAGGTACACCAATCAATCATAGG + Intergenic
914968097 1:152279035-152279057 CAGGAACACCAATTATTTTTAGG - Intergenic
914969386 1:152293344-152293366 CAGGTACACCAATCAATCATAGG - Intergenic
915011650 1:152692401-152692423 CAGGTACACCAATCAGACTTAGG - Intergenic
915649259 1:157295731-157295753 CAGGTACACCAGTCAAACATAGG - Intergenic
915654335 1:157346897-157346919 TAGGTATATCAATCAAATGTAGG + Intergenic
915688606 1:157663146-157663168 CAGTTACACCAATCAAATGTAGG - Intergenic
915758018 1:158281801-158281823 CAAATACACCAATCAAATGTAGG + Intergenic
915846384 1:159270075-159270097 CAGGTACACCAATCAATTATAGG - Intergenic
915936012 1:160090771-160090793 CAGGTACAGCGAGTACATGTGGG + Intergenic
916140710 1:161694646-161694668 CAGGTACACCAATCAATTATAGG - Intergenic
916343333 1:163760084-163760106 CAGGTACTCCAATCAGTTGTAGG - Intergenic
916362997 1:163991653-163991675 CAGGTACACCAATCAAATGTAGG - Intergenic
916406435 1:164501995-164502017 CAGGTACACCAATCAAATGTAGG - Intergenic
916916254 1:169409403-169409425 CAGGTACACCAATCAAACGTAGG - Intronic
916938697 1:169657768-169657790 CAGTTACACTAATCAAACGTAGG - Intergenic
917009627 1:170456669-170456691 CAGGTACAACAATAATACGTAGG + Intergenic
917019534 1:170570688-170570710 CAGGTACACCAATCAAAGGTAGG - Intergenic
917289982 1:173461947-173461969 CAGGTACCCCAATCAGTTGTAGG - Intergenic
917357913 1:174145382-174145404 CAGGTACACCAATCAAACGTAGG - Intergenic
917383197 1:174437582-174437604 CAGGTACACCAATTACACGTAGG - Intronic
917406108 1:174710176-174710198 CAGGTACACCAGTCAAACGTAGG - Intronic
917714569 1:177721535-177721557 CAGGTACGCCAATGAAACATAGG + Intergenic
918159429 1:181883725-181883747 CAGGTACACCAATCAAATGTAGG - Intergenic
918160179 1:181890892-181890914 CAGGTACACCAAACAAATGTAGG - Intergenic
918195827 1:182220288-182220310 CAGGTACACCAATCAAACATAGG - Intergenic
918353612 1:183683793-183683815 CAGGTACACCAATCAAATGTAGG + Intronic
918360237 1:183750187-183750209 CAGGTACACCAATCAAACGTAGG + Intronic
918413586 1:184285352-184285374 GGGGTAAATCAATTAAATGTTGG + Intergenic
918501345 1:185199872-185199894 CAAGTACACCAATCAAATGTAGG + Intronic
918612672 1:186511038-186511060 CAGGTGCACCAATCAAATGTAGG + Intergenic
918631918 1:186729231-186729253 CAGGTACACCAATAAAACATAGG + Intergenic
918945729 1:191061920-191061942 CAGGTACACCAGTCAAACGTAGG + Intergenic
918955381 1:191200227-191200249 CAGGTACTCCAGTCAATTGTAGG - Intergenic
918999507 1:191812078-191812100 CAGGTACAGAAAATAAATTTTGG + Intergenic
919062272 1:192648613-192648635 CAGGTACAGAAAAAAAATGTAGG + Intronic
919146622 1:193644018-193644040 CATGTATACCAATCAAATGTAGG + Intergenic
919223322 1:194660393-194660415 CAGGTTCACCAATCAAACATAGG - Intergenic
919599149 1:199600977-199600999 CAGGCACACCAATCAAATGTAGG - Intergenic
919602057 1:199634362-199634384 CAGGTACACTAATCAAACATAGG - Intergenic
920625170 1:207589972-207589994 CAGGTACACCAATCAAACGTAGG - Intronic
920985739 1:210886910-210886932 CAGGTACATCAATCAAACATAGG - Intronic
920993518 1:210963805-210963827 CTGGTACACCAATCAAATGTAGG - Intronic
921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG + Intronic
921626344 1:217381160-217381182 CAGGTACACCAATGAAACGTAGG - Intergenic
921738141 1:218652397-218652419 CTGGTACTCCAATCAAACGTAGG + Intergenic
921842269 1:219840836-219840858 CAGGTACACCAATCAGATGTAGG - Intronic
922066366 1:222147286-222147308 CAGGTACACCAATCAAACGTAGG - Intergenic
922202044 1:223412195-223412217 AAGCTACCCCAAATAAATGTTGG - Intergenic
922253267 1:223869772-223869794 CAGGTACACCAATCAATCATAGG + Intergenic
922379865 1:225012588-225012610 CAGGTACACCAATCAAACGTAGG + Intronic
922396945 1:225211514-225211536 CAGGTACACCAATCAAATGTAGG - Intronic
922406080 1:225315065-225315087 CAAGTACACCAATCAAATGTTGG + Intronic
923054858 1:230418389-230418411 CAGGTAAAACAATTAAGTATTGG + Intronic
923066806 1:230525889-230525911 CACTTACACCAATCAAACGTAGG + Intergenic
923421881 1:233823799-233823821 CAGGTACACCAATCAAACACAGG - Intergenic
924493842 1:244567474-244567496 CAGGTACACCAATCAAATATAGG + Intronic
924614019 1:245597757-245597779 CAGGTACACCAATCAAACATAGG + Intronic
924822956 1:247512134-247512156 CAGGTATACCAATCAAATGTAGG + Intronic
924828870 1:247571827-247571849 CAGGTACACCAATCAAATGTAGG + Intronic
924868376 1:248011577-248011599 CAGGTATACCAATCAAATGTAGG + Intronic
1062760943 10:18298-18320 CAGGTACACCAATTAGTGTTAGG - Intergenic
1063095573 10:2905777-2905799 CTGGGACACCCATTAATTGTTGG + Intergenic
1063338145 10:5236283-5236305 CAGGTACACCAATCTAATGTAGG - Intergenic
1064789336 10:18938148-18938170 CAGGTACACCAATCAAACGTAGG + Intergenic
1065621758 10:27588825-27588847 CAGGTACACCAATAAAATGTAGG - Intergenic
1065651890 10:27900827-27900849 CAGGTACACCAATCAAAAGTAGG - Intronic
1066042772 10:31567438-31567460 CAGGTACACCAATCAAACATAGG + Intergenic
1066747227 10:38612783-38612805 CAGGTACACCAATTAGTCTTAGG - Intergenic
1067162038 10:43835202-43835224 CAAGTACACCAATCAAACCTAGG + Intergenic
1067252180 10:44595651-44595673 CAGGTACACCAGTCAATTATAGG - Intergenic
1067734227 10:48837000-48837022 CAGGTACACCATGGCAATGTGGG + Intronic
1067903245 10:50263893-50263915 CAGGTACACCAATCAGATGTAGG - Intergenic
1067996596 10:51280498-51280520 CAGGTACACCAATCAGATGTAGG + Intronic
1068085939 10:52373854-52373876 CAGGTATACCAATCAAATGCAGG + Intergenic
1068113685 10:52711893-52711915 TAAGTACACCAATTAAAAGATGG - Intergenic
1068490483 10:57717586-57717608 CTGGTACACCAATCAAACGTAGG - Intergenic
1068516869 10:58035970-58035992 CAGGTACACCAATCAAACGTAGG + Intergenic
1068575307 10:58677561-58677583 CAGGTACACCAATCAAACGTAGG - Intronic
1068623161 10:59208940-59208962 CAGGTACACCAATCAAATGTAGG - Intronic
1069093326 10:64228612-64228634 CAGGTACACCAATCAAATGTAGG + Intergenic
1069368722 10:67721285-67721307 CAGGTACACCAATCAAACTTAGG + Intergenic
1070213329 10:74348927-74348949 CAGGTACACCAATCAATCATAGG - Intronic
1070234302 10:74607859-74607881 CAGGTACACCAATCAAATGTAGG + Intronic
1070709388 10:78667842-78667864 CAGGTACACCAATAAAATGTAGG - Intergenic
1071001866 10:80840378-80840400 CAGGGACCCCAATCAATTGTAGG + Intergenic
1071045835 10:81375463-81375485 CGGGAACACCAATTAATTTTAGG + Intergenic
1071071445 10:81698421-81698443 CTGGTACTCCAATTAATTGTAGG - Intergenic
1071272568 10:84021426-84021448 CACGTACACCAATCAAACGTAGG - Intergenic
1072024632 10:91442711-91442733 CAGATACACCAAAAAAACGTAGG + Intronic
1072025065 10:91446884-91446906 CAGATACACCAAAAAAACGTAGG - Intronic
1072045040 10:91645674-91645696 CAGGTATACCAATAAAATGTAGG - Intergenic
1072394558 10:95025388-95025410 CAGGTACACCAATGAAATGTAGG + Intergenic
1072493544 10:95933008-95933030 CAGGTACACCAATCAAATGTAGG + Intronic
1072876341 10:99176636-99176658 CAGGTACACCAATCAAACTTAGG - Intronic
1072953407 10:99868598-99868620 CAGGTATACCAATCAATTGTAGG + Intergenic
1073816450 10:107213128-107213150 CAGGGACACCAATGAGCTGTAGG + Intergenic
1073884329 10:108020622-108020644 CAGGCACAATAATCAAATGTAGG - Intergenic
1073962532 10:108950045-108950067 CAGGTACACTAATCAAATGTAGG - Intergenic
1074003499 10:109394993-109395015 CTGGTATTCCAATTAATTGTAGG - Intergenic
1074795349 10:116937790-116937812 CCAGTACACCAATCAAACGTAGG + Intronic
1074836341 10:117299438-117299460 CAGGAACACCAGTTATTTGTAGG + Intronic
1075281948 10:121146658-121146680 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1075963507 10:126589221-126589243 CAGGTACCCCAATCAGTTGTAGG - Intronic
1075983757 10:126765677-126765699 CAGGTACACCAATCAAATGTAGG + Intergenic
1076389956 10:130091929-130091951 CAGGTACACTAGTCAAATGTAGG - Intergenic
1076716668 10:132369148-132369170 CAGGAACACTCATTAATTGTTGG + Intronic
1077428148 11:2497293-2497315 CAGGTACAGCAATCAATTGTAGG + Intronic
1077696591 11:4398373-4398395 CAGGTACACCAATCAAATGGAGG - Intergenic
1078331336 11:10424718-10424740 TAGGTACATCAATCAAATGTAGG + Intronic
1078336513 11:10467531-10467553 CAGGTACATCCATCAAACGTAGG - Intronic
1078743263 11:14088759-14088781 CAGGTACCCCAATCAATTGTAGG + Intronic
1078998504 11:16729094-16729116 CAGGTACACCCATCAAATGTAGG - Intronic
1079262406 11:18896230-18896252 CAGGTACACCAATCAAATGTCGG + Intergenic
1079265036 11:18922617-18922639 CAGTTGCACCAATCAATTGTAGG - Intergenic
1079267211 11:18944761-18944783 CAGTTGCACCAATCAATTGTAGG - Intergenic
1079316691 11:19413438-19413460 CAGGTACACCAATCAAACGTAGG - Intronic
1079598802 11:22286146-22286168 CAGGTACACCAATCAGATGTAGG - Intergenic
1079715069 11:23733416-23733438 CACATACACCAATCAAATATAGG - Intergenic
1079868059 11:25759820-25759842 CAGGTACACCAATCAAACGTAGG - Intergenic
1079993593 11:27272526-27272548 CAAGTACACCAATCAAACATAGG + Intergenic
1080033446 11:27687033-27687055 CAGGTACACCAATGAAATGTAGG + Intronic
1080164739 11:29223582-29223604 CTGGTACTCCAATCAATTGTAGG + Intergenic
1080334687 11:31182106-31182128 CAAGTATACCAATCAAACGTAGG - Intronic
1080710202 11:34739309-34739331 CAGGTACACCAGTCAAACGTAGG - Intergenic
1080744090 11:35092168-35092190 CAGGTACACTAATCAAGCGTAGG - Intergenic
1080977301 11:37358079-37358101 CAGGTACACCAATCAAATGTAGG - Intergenic
1081080067 11:38730740-38730762 CAGGTCCACCAATTAAATGTAGG + Intergenic
1081094814 11:38919960-38919982 CAGGTACATCAATCAAATGTAGG + Intergenic
1081166203 11:39811483-39811505 CAGGTACACCAATCAATCATAGG - Intergenic
1081198963 11:40193970-40193992 CAGGTACACCAATCAAACATAGG - Intronic
1081252193 11:40849764-40849786 CAGGTATACCAATCAAACATAGG + Intronic
1081317588 11:41649713-41649735 CAGGTACACCAATCAAACATAGG + Intergenic
1081363438 11:42206846-42206868 CAGGTACACCAATCAAATGTAGG - Intergenic
1081385294 11:42464946-42464968 CAAGTCCACAAATTATATGTAGG - Intergenic
1081593072 11:44438832-44438854 CAGGTACACCAGTCAAACATAGG - Intergenic
1082182732 11:49140171-49140193 CAGGTACACCAATCAGACATAGG - Intergenic
1082876175 11:57991321-57991343 CAGGTATACTAATCAATTGTAGG + Intergenic
1082956500 11:58875918-58875940 CAGGTACACCAGTTAGACGTAGG + Intronic
1083385372 11:62305261-62305283 CAGGTACACCAATCAAATGTAGG + Intergenic
1083499333 11:63088938-63088960 CAGGGACACCAATTTATCGTAGG - Intronic
1083528341 11:63393925-63393947 CAGGTACACCAAGCAAATGTGGG + Intronic
1085335017 11:75686757-75686779 CAGGTACTCCAATCAGTTGTAGG + Intergenic
1085434026 11:76482765-76482787 CAGGTAAACCAATCAAACGCAGG - Intronic
1085850233 11:80110857-80110879 CAGGTACTCCAATCAATCGTAGG - Intergenic
1086067719 11:82764174-82764196 CAGGTACACCAATCAAACATAGG + Intergenic
1086129359 11:83384484-83384506 CAGGTACACCAATCAAACATAGG - Intergenic
1086300179 11:85419558-85419580 CAAGTACACCTATCAAATGTAGG + Intronic
1086422064 11:86646565-86646587 CAGGTACACCAATCAAACGTAGG - Intronic
1086475589 11:87169928-87169950 CAGGTACACCAATCAAACATAGG + Intronic
1086505458 11:87499213-87499235 CAGGTACACCAAACAAACATAGG - Intergenic
1086513985 11:87590474-87590496 CAGGTACACCAATCAATTGTAGG - Intergenic
1086532209 11:87799811-87799833 CAGGTACACCAATCATATGTAGG + Intergenic
1086538971 11:87884917-87884939 CAGGTAGAACATTTAACTGTGGG + Intergenic
1086608596 11:88726402-88726424 CAGGTACACCAATCAAACACAGG - Intronic
1086645127 11:89210482-89210504 CAGGTACACGAATCAAATGTAGG - Intronic
1086869233 11:92017089-92017111 CAGGAACACCAATTATTTTTAGG + Intergenic
1086906988 11:92430004-92430026 CAGGTATACTAATCAAAGGTAGG + Intronic
1087089114 11:94249546-94249568 CAGGTACACCAGTCAGACGTAGG - Intergenic
1087316855 11:96613731-96613753 CAGGTACTCCAATCAATTGTAGG + Intergenic
1087427930 11:98013884-98013906 CAGGTACACCAATCAATCATGGG - Intergenic
1087695154 11:101368420-101368442 CAGGTACACCAATCTAACATAGG + Intergenic
1087703642 11:101465415-101465437 CTGGTACACTAATCTAATGTAGG + Intronic
1087760813 11:102102769-102102791 CAGAGAAGCCAATTAAATGTTGG + Intergenic
1087830827 11:102818516-102818538 CAGGTACACCAATCAAACGTAGG + Intergenic
1088078152 11:105877536-105877558 CAGGTACACCAATCAAATGTAGG + Intronic
1088211784 11:107465159-107465181 CAGGTACACCAATCAAATGCAGG + Intergenic
1088307395 11:108424419-108424441 CAGGTATATCAATCAAATGTAGG - Intronic
1089765876 11:120765084-120765106 CAGGTACACCAATCAAACGTAGG + Intronic
1089882297 11:121786450-121786472 CAGTTACATCAATCAAATATAGG + Intergenic
1090106283 11:123856150-123856172 CAGATACGCCAATCAATTGTAGG - Intergenic
1090720559 11:129468556-129468578 CAGGTACAACAATCAAACGTAGG - Intergenic
1090928317 11:131272380-131272402 TAGGTACACCAATCAAACGTAGG + Intergenic
1091213373 11:133883886-133883908 CAGGTATACCAATCAATCGTAGG + Intergenic
1091604804 12:1941137-1941159 CAGGTACACCAATCAAATGTAGG + Intergenic
1092320876 12:7473088-7473110 CAGGTACACCAATCAATCATAGG - Intronic
1092398756 12:8153377-8153399 CAGGTATACCAATCAAACATAGG + Intronic
1092639052 12:10483189-10483211 CAGGTACACCAATGAAATGGAGG - Intergenic
1092703406 12:11257863-11257885 CAGGTACACCAATCAAATGTAGG - Intergenic
1093004585 12:14037287-14037309 CAGGTACATCAATCAAATGTAGG - Intergenic
1093248826 12:16773868-16773890 CAGGTACAACAATCAAATGTAGG + Intergenic
1093402452 12:18762433-18762455 CAGGTACACCAGTCAAATGTAGG - Intergenic
1093544893 12:20335235-20335257 CAGGTACACCAATCAAATGTAGG + Intergenic
1093595387 12:20952619-20952641 CAGGTGCACCAATCAAATGTAGG - Intergenic
1093664313 12:21794174-21794196 CAGGTACACTAATCAAATGTAGG + Intergenic
1093694923 12:22148017-22148039 CAGGTACACCACTCAAACGTCGG - Intronic
1093714654 12:22367452-22367474 CAGGTACACCAATCAAAGGTAGG - Intronic
1093835458 12:23823743-23823765 CAGGTACACCAATCAAACGTAGG + Intronic
1093836022 12:23829633-23829655 CAGGTACACCATTTATCTGAGGG + Intronic
1093902658 12:24653713-24653735 CAGGTACACCAATCAAATGTAGG + Intergenic
1094060923 12:26314942-26314964 CAGGTACACCAATAAATCGTAGG + Intergenic
1094336347 12:29359696-29359718 CAGTTTCACCACTTGAATGTGGG - Intronic
1094371884 12:29747968-29747990 CAGGTAAAGCAAATAAAAGTTGG - Intronic
1094579162 12:31718045-31718067 CAGGTACACCAATCAATCGTAGG + Intronic
1094728348 12:33146403-33146425 CAAGTACACCAATCAAACGTAGG + Intergenic
1094730118 12:33164793-33164815 AAGGTACACCAATCAAATATAGG - Intergenic
1094732842 12:33198495-33198517 CAAGTACACCAATCAAACGTAGG + Intergenic
1094758010 12:33494086-33494108 CAGGTACACTAGTCAAATGTAGG - Intergenic
1094781918 12:33801483-33801505 CAGGTACACCAATCGAACATAGG + Intergenic
1094861998 12:34477804-34477826 CAGGTACACCAATCAGACATAGG - Intergenic
1095033312 12:37322510-37322532 CAGGTACACCAATCAGACGTAGG + Intergenic
1095230214 12:39730779-39730801 CAGGTACACTAATCAAATGTAGG + Intronic
1095356577 12:41281731-41281753 CAGGTACACCAGTGAAACATAGG - Intronic
1095406446 12:41871666-41871688 CAGGTACACCAATCAAGCGTAGG - Intergenic
1095488651 12:42709666-42709688 CCGGTACAACAATCAAACGTAGG - Intergenic
1095547203 12:43386613-43386635 CAGGTACACCAATCAAACATAGG + Intronic
1095674391 12:44899127-44899149 CAAGTACACCAGTCAAATGTAGG - Intronic
1095779034 12:46038368-46038390 CAAGTACACCAATCAAACGTAGG - Intergenic
1095831334 12:46590304-46590326 CAGGGACCCCAATCAATTGTAGG + Intergenic
1095917978 12:47499078-47499100 CAGGTACACCAATCAAACATAGG - Intergenic
1095920471 12:47525210-47525232 CAGGTACACCAATCAATTGTAGG + Intergenic
1096027899 12:48383733-48383755 CAGGTGCACCAATCAAATGTAGG + Intergenic
1097148657 12:56959753-56959775 CAGGTACAGCAGTCAAACGTAGG - Intergenic
1097304403 12:58053312-58053334 CAGGTACACCAGTCAGATGTAGG - Intergenic
1097340080 12:58427379-58427401 CAGGTACACCAATCAAACATAGG - Intergenic
1097349712 12:58535444-58535466 CACCCACACCAATTAAATCTGGG - Intergenic
1097412270 12:59269401-59269423 CAGGTACACCAATCAACCATGGG - Intergenic
1097422000 12:59391513-59391535 CAGGTACTCCAATCAGTTGTAGG - Intergenic
1097460630 12:59857645-59857667 CAGGTACACCAATCAAATGTAGG - Intergenic
1097488581 12:60236162-60236184 CAGGTACACCAATCAAACGTAGG - Intergenic
1097517312 12:60621254-60621276 CTGTTACACCAATCGAATGTAGG - Intergenic
1097521023 12:60671413-60671435 CAGGTACTCTAATTAATTCTAGG + Intergenic
1097526778 12:60746952-60746974 CAAGTACACCAATCAATAGTAGG - Intergenic
1097619659 12:61924102-61924124 CAGGTACACCAATGAAACGTAGG - Intronic
1097635048 12:62112610-62112632 TAGGTACACCAATGAAACGTAGG + Intronic
1097654260 12:62342037-62342059 CAGTTACACTAATCAATTGTAGG + Intronic
1097898647 12:64852145-64852167 CAGGTACACCACTCAAATGTAGG + Intronic
1097948663 12:65402239-65402261 CGGGTACACCAGTCAAACGTAGG + Intronic
1098053088 12:66474341-66474363 CAGGTACACCAATCAAATGTAGG - Intronic
1098680722 12:73350004-73350026 CAGGTACACCAATCAAATGTAGG + Intergenic
1098780309 12:74677843-74677865 CAGGTACACCAATCTAACATAGG - Intergenic
1098982543 12:76973191-76973213 CAGGTACACCGATTAATCTTAGG + Intergenic
1099010699 12:77287711-77287733 CAGGTACACCAATCAAACATAGG - Intergenic
1099235954 12:80082895-80082917 CAGGTACACCAATCAAACATAGG + Intergenic
1099238787 12:80114742-80114764 CATGTATACCAATCAAATGTAGG + Intergenic
1099344399 12:81480035-81480057 CAGGTACACCAATCAAACGTAGG + Intronic
1099345352 12:81492977-81492999 CAGGTTGAACAATTATATGTGGG + Intronic
1099527638 12:83735358-83735380 CAGATACACCAATCAAATGTAGG + Intergenic
1099590063 12:84575470-84575492 TAGGTACCCCAATCAATTGTAGG - Intergenic
1099744824 12:86688973-86688995 CAGGTACACCAATCAAACATAGG + Intronic
1099797653 12:87419778-87419800 CAGGTACACCAATCAAACATAGG + Intergenic
1099809070 12:87557685-87557707 CAGGTACACCAATCAATTGTAGG - Intergenic
1099892384 12:88605846-88605868 CAGGTACCCCAATCAAACATAGG - Intergenic
1099897686 12:88668968-88668990 CAGGTAAACCAATCAAATGTAGG - Intergenic
1100111210 12:91244069-91244091 CAGGTACACCAATCAAACATAGG - Intergenic
1100136432 12:91558300-91558322 CAGGTACACTAATCAAATGTAGG - Intergenic
1100740195 12:97582901-97582923 CAGGTACACCAATCAAACATAGG - Intergenic
1100798149 12:98203493-98203515 CAGGTACACCAATCAAACATAGG - Intergenic
1100896410 12:99187201-99187223 CAGGTACACCAACCAAACGTAGG - Intronic
1100941250 12:99724519-99724541 CAGGTACTCCAGTCAATTGTAGG - Intronic
1100996121 12:100302879-100302901 CAGGTACACCAGTCAAACGGAGG + Intronic
1101069697 12:101061509-101061531 CAGGTACACCAATCAAATGTAGG + Intronic
1101206444 12:102493022-102493044 CAGATACACCATTCAAATGTAGG + Intergenic
1101296293 12:103426474-103426496 CAGGTACACCAGTCAAACGTAGG - Intronic
1101472513 12:105012118-105012140 CAGGTACACCAATCAAACGTAGG + Intronic
1101487844 12:105183885-105183907 CAGGTACACCAATCAAATATAGG + Intronic
1101595999 12:106164960-106164982 CAGGTACACCAATCAATCATAGG - Intergenic
1101783492 12:107860877-107860899 CAGGTACACCAATCAAACGTAGG - Intergenic
1102345412 12:112157833-112157855 CAGGTACACCAATCAAATGTAGG + Intergenic
1102372648 12:112395077-112395099 CAGGTACACCAATCAATTGCAGG - Intergenic
1103169008 12:118797761-118797783 CAGGTACACCAATCAATCGGAGG + Intergenic
1103272049 12:119681507-119681529 CAGGTATACCAAGTAAATACTGG - Exonic
1104256240 12:127141927-127141949 CTGGTACTCCAATCAATTGTAGG + Intergenic
1104472548 12:129042181-129042203 CAGGTACACCAAACAGACGTAGG + Intergenic
1105286151 13:19006350-19006372 CAGGTACACCAATCAATTGTAGG + Intergenic
1105311401 13:19215355-19215377 CAGGTACACCAATCAGATGTAGG + Intergenic
1105645641 13:22315069-22315091 CAGGTACACCAATCAAATGTAGG + Intergenic
1105672542 13:22635696-22635718 CATGTACACCAATCAAACGTAGG + Intergenic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1105835986 13:24212333-24212355 CAGGTACCTCATTTAAATGGAGG + Intronic
1105875866 13:24553038-24553060 CAGGTACACCAATCAGATGTAGG + Intergenic
1106042351 13:26105037-26105059 CAGGTACACCAATCAAACATCGG - Intergenic
1106157092 13:27169603-27169625 CAGATACATTAATTACATGTGGG - Intronic
1106361728 13:29037639-29037661 CAGGTACACCAATCAAATGTAGG + Intronic
1106377283 13:29202132-29202154 CAGGTACACCAATCAAACATTGG + Intronic
1106426429 13:29635281-29635303 CAGGTGCATCAATCAAATGTAGG + Intergenic
1106429582 13:29667090-29667112 CAGGTACACCAATCAAATGTAGG - Intergenic
1106874158 13:34054180-34054202 CAGGTACACCAATCAATCATAGG + Intergenic
1106983710 13:35320723-35320745 CAGGTACACCAGTCAAACGTAGG + Intronic
1107118022 13:36767891-36767913 CAGATACACAATGTAAATGTTGG - Intergenic
1107189714 13:37565889-37565911 CCTGCACACCAATTAAAGGTTGG - Intronic
1107289665 13:38838588-38838610 CAGGTACACCAATCAAACGTAGG + Intronic
1107473309 13:40711494-40711516 CAGGTACACCAATCAAACGTAGG + Intergenic
1107641800 13:42451792-42451814 CAGGTACACCAATCAAACATAGG + Intergenic
1107648323 13:42517803-42517825 CAAGTACACCAATCAAACATAGG - Intergenic
1107673925 13:42775572-42775594 CAGGTACACCAATCAAACATAGG + Intergenic
1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG + Intergenic
1108029926 13:46219229-46219251 CAGGTACACCAATCAAATGTAGG + Intronic
1108048658 13:46407691-46407713 CAGGTACACCAGTCAAACGTGGG + Intronic
1108056282 13:46488667-46488689 CAGCTAAATCAAGTAAATGTAGG - Intergenic
1108235208 13:48395745-48395767 CAGGTACACCAATCAAACATAGG - Intronic
1108262640 13:48674250-48674272 CAGGTACACCAATCAGATGTAGG + Intronic
1108304758 13:49119853-49119875 CAGGTATACCAATCAAACATAGG - Intronic
1108673879 13:52719954-52719976 CAGGTACACCAGTCAAATGTAGG + Intronic
1108793347 13:53999748-53999770 CCCGTAGTCCAATTAAATGTAGG - Intergenic
1108998456 13:56764651-56764673 CAGGTACACCAATCAAACGTAGG - Intergenic
1109034005 13:57231439-57231461 CAGGTACACCAATCAAACGTTGG - Intergenic
1109196074 13:59378641-59378663 CAGGTACACCAATCAAATGTAGG - Intergenic
1109293814 13:60505895-60505917 CAGGTACACCAATCAAATGTAGG - Intronic
1109457308 13:62610119-62610141 CAGGTACACCAATCAAACGTAGG + Intergenic
1109541192 13:63781036-63781058 CAGGTACACCAGTCAAACGTGGG + Intergenic
1109625129 13:64963998-64964020 CAGGAACACCAATTATTTTTAGG - Intergenic
1109626507 13:64981730-64981752 CAGGTACGCCAATCAAACATAGG + Intergenic
1109635386 13:65108516-65108538 CAGGTACACTAATCAAATGTAGG + Intergenic
1109731708 13:66421193-66421215 CAGGTATACCAATCAAACATAGG - Intronic
1109968896 13:69738765-69738787 CAGGTACCCCTATCAGATGTAGG - Intronic
1110020105 13:70458815-70458837 CAGGTATACCAATCAAATATAGG - Intergenic
1110135650 13:72063783-72063805 CAGGTACACCAATCAAATGTAGG - Intergenic
1110389866 13:74960981-74961003 CCGGTACACCAATCAAATGTAGG - Intergenic
1110824879 13:79959938-79959960 CAGATACACCAACCAAATGTAGG - Intergenic
1110878669 13:80542560-80542582 CAGGTACACCTATCAAATGTAGG + Intergenic
1110890440 13:80691159-80691181 CAGGTACACCAATCAAATGTAGG - Intergenic
1111114358 13:83755890-83755912 CAGGTCCATCAATGAAACGTAGG - Intergenic
1111544868 13:89719217-89719239 CAGTTACACCAATCAAACGTAGG + Intergenic
1111628114 13:90814716-90814738 CAGGTACACCAATCAAATGTAGG - Intergenic
1112152080 13:96774695-96774717 CAGGTACCCCAATCAAACGTAGG - Intronic
1112166008 13:96920236-96920258 CAAGTAAACCAATCAAATGTAGG - Intergenic
1112231754 13:97594722-97594744 CAGGTACACCAATTAATCATAGG - Intergenic
1114133387 14:19819313-19819335 CAGGTACACCAATCAAACGTAGG + Intronic
1114360684 14:21968811-21968833 CAGGTACACCAATCAAACGTAGG - Intergenic
1114710223 14:24769965-24769987 CAGGTACACTAATCAAACATAGG - Intergenic
1114817822 14:25980682-25980704 CAGGTACACCAATCAAACGTAGG - Intergenic
1114845044 14:26310430-26310452 CAGGCATGCCAATCAAATGTAGG - Intergenic
1114958334 14:27850467-27850489 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1115048543 14:29028007-29028029 CAGGCACACCAATCAAATGTAGG + Intergenic
1115124355 14:29973850-29973872 CAGGTACACCAATCAATCATAGG - Intronic
1115162184 14:30409095-30409117 CAGGTACACCAATCAAACATAGG + Intergenic
1115281356 14:31667177-31667199 CAGGTACACCAATCAATCGTAGG + Intronic
1115295112 14:31817186-31817208 CAGGTACACCAATGAAACGTAGG - Intronic
1115339236 14:32274213-32274235 CAGGTACATCAATCAATCGTAGG - Intergenic
1115357323 14:32462093-32462115 CAGGTACACCAATCAATCATAGG - Intronic
1115511430 14:34141153-34141175 CAGGTACACCAATCAAATGTAGG - Intronic
1115538213 14:34393027-34393049 CAGGTACACCAATCAAATGTAGG - Intronic
1115843789 14:37503127-37503149 CAGGTACACCAATCAAGATTTGG - Intronic
1115856107 14:37631740-37631762 CAGGTACACCAATCAAACATAGG + Intronic
1115867070 14:37759627-37759649 CAGGTATACCAATCAATCGTAGG + Intronic
1115912011 14:38267569-38267591 CAGGTACACCAATCAAATGTAGG + Intergenic
1115974252 14:38979815-38979837 CAGGTACACCAATCGAACGTAGG + Intergenic
1116009283 14:39332068-39332090 CAGGTACACCAATCAAATATAGG + Intronic
1116227474 14:42170697-42170719 CAGGTATACCAATCAAATGTAGG + Intergenic
1116262324 14:42646436-42646458 TAAGTACACCAATCAAACGTAGG - Intergenic
1116301563 14:43189561-43189583 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1116511740 14:45755243-45755265 CAGGTACACCAATCAAATGTAGG + Intergenic
1116560769 14:46376221-46376243 CTGGTACTCCAATCAATTGTAGG + Intergenic
1116572288 14:46533702-46533724 CAGGTACACGAATTAAACATAGG + Intergenic
1116765308 14:49063278-49063300 CAGGTACACAAATCAAACGTAGG - Intergenic
1116771308 14:49130398-49130420 CAGGCACACCAATCAAACGTAGG + Intergenic
1116775869 14:49179988-49180010 CAGGTACACCAATCAAATGTAGG - Intergenic
1116781935 14:49245622-49245644 CAGGTACACCAATGAATCGTAGG - Intergenic
1116792375 14:49353186-49353208 CAGGTACACAAATCAAACGTAGG + Intergenic
1117104428 14:52383663-52383685 CAGGTACACCAGTCAAACATAGG - Intergenic
1117172557 14:53115240-53115262 CAGGTATACCAGTTAAACTTAGG - Intronic
1117238121 14:53799685-53799707 CAGGTACACCAATCAAATGTAGG - Intergenic
1117299090 14:54406467-54406489 CAGGTACACCAGTCAAACATAGG + Intronic
1117466358 14:55998690-55998712 CAGGTACACCAATCAAATGTAGG + Intergenic
1117509996 14:56441738-56441760 CAGGTACACCAATTATTCGTAGG + Intergenic
1117710872 14:58527218-58527240 CAGGTACACCAATCAGATGTAGG - Intronic
1117822008 14:59659253-59659275 CAGGTACACCAATCAAATGTAGG - Intronic
1117859522 14:60074974-60074996 CATGTACACCAGTCAAATGTAGG - Intergenic
1117930384 14:60835861-60835883 CAGGTACACCAGTCAAACGTAGG + Intronic
1118515933 14:66529091-66529113 CATGTACACCAATCAAACGTAGG + Intronic
1118521314 14:66588746-66588768 CAGGTACACCAATCAAACATAGG - Intronic
1118558389 14:67051474-67051496 CAGGTACCCCAATCAGTTGTAGG - Intronic
1118926848 14:70198898-70198920 CAGGTACACCAATCAATTGTAGG + Intergenic
1119018316 14:71083477-71083499 CAGGTACACCAATCAAATGTAGG + Intronic
1120137423 14:80886143-80886165 CAGGTACACCAATGAAACATAGG - Intronic
1120449899 14:84654149-84654171 CAGGTACACAAATCAAACATAGG + Intergenic
1120507564 14:85371560-85371582 CAGGTACACTAATCAAAGGTAGG + Intergenic
1120553963 14:85906545-85906567 CAGGTACACCAATCAAATGTAGG + Intergenic
1120565189 14:86046964-86046986 CAGGTACACCAATCAAACGTAGG + Intergenic
1120843006 14:89103444-89103466 CAGGTACACCAATCCAACATGGG + Intergenic
1121470588 14:94151308-94151330 CAGGTACACCAAACAAACATAGG + Intronic
1123480983 15:20630602-20630624 CAGGTACACCAGTCAAACGAAGG - Intergenic
1123576471 15:21675122-21675144 CAGGTACACCAATCAAACGTAGG + Intergenic
1123613095 15:22117590-22117612 CAGGTACACCAATCAAACGTAGG + Intergenic
1123637028 15:22369763-22369785 CAGGTACACCAGTCAAACGAAGG + Intergenic
1124419346 15:29506271-29506293 TAGGTACACCAATCAATCGTAGG - Intronic
1124894109 15:33759658-33759680 CAGGTACACCAATCAAACGTAGG - Intronic
1125227321 15:37409657-37409679 CAGGTACACCAATCAAACATAGG - Intergenic
1125235039 15:37503161-37503183 CAGGTACTCCAATCAGTTGTAGG - Intergenic
1125288668 15:38121243-38121265 CAGGTACACCAATCAAACATAGG - Intergenic
1125329849 15:38572217-38572239 CAGGTACACCAATCAAATGTAGG + Intergenic
1126264890 15:46742527-46742549 CAGGTACACCAATCAAACGTAGG - Intergenic
1126284431 15:46995428-46995450 CAGGTACTCCAGTGAATTGTAGG + Intergenic
1126292993 15:47102329-47102351 CAGGCACACAAATAAAATATTGG - Intergenic
1126470604 15:49006375-49006397 CAGGTACACCAATCTAACGTAGG + Intronic
1126542365 15:49837852-49837874 CAGGTACACCAATCAGATGTAGG + Intergenic
1126554236 15:49967637-49967659 CAGGTACACCAATGAAACGTAGG - Intronic
1127030169 15:54852550-54852572 CAGGTACACAAATCAAATGTAGG - Intergenic
1127056441 15:55136718-55136740 CAGGTACACCAATTAAAGGTAGG - Intergenic
1127373888 15:58364418-58364440 CAGGTACACCAATCAAACGTAGG - Intronic
1128852359 15:70972612-70972634 CAGGTACAGCAATCAAATGTAGG + Intronic
1128857352 15:71030644-71030666 CAGGTACACCAATCAATCGTAGG + Intronic
1128883838 15:71266976-71266998 CAGGTACACCAATCAAACATAGG - Intronic
1129495425 15:75975980-75976002 CAGATACACCAATCAAACATAGG + Intronic
1129498990 15:76017954-76017976 TAGGTACACCAATCAAATGTAGG + Intronic
1130442077 15:83964537-83964559 CAGGTACACCAAACAAACGTAGG - Intronic
1130728396 15:86465031-86465053 CAGGTACACCAATCAAATGTAGG + Intronic
1130779331 15:87018135-87018157 CAGGTACCCCAATCCATTGTAGG - Intronic
1130800795 15:87261407-87261429 CAAGTACACCAATCAAACGTAGG + Intergenic
1131293547 15:91128093-91128115 CAGGGACTCAAATTAAATCTGGG + Intronic
1131740888 15:95390190-95390212 CAGGTACACCAATCAAATGTAGG + Intergenic
1202985339 15_KI270727v1_random:409367-409389 CAGGTACACCAATCAAACGTAGG + Intergenic
1133620735 16:7523886-7523908 AAGGTACACCCCATAAATGTAGG - Intronic
1135725051 16:24847818-24847840 TTGGTACAACAAATAAATGTGGG - Intronic
1135807710 16:25557659-25557681 CAGGTACAACAATCAAACGTAGG - Intergenic
1135816783 16:25641801-25641823 CAGGTTCACAAATGAACTGTGGG - Intergenic
1135898938 16:26437986-26438008 CAGGTACAACAAGTAGTTGTTGG - Intergenic
1136643357 16:31587673-31587695 CAGGTACCCCAATTAGTTGTAGG + Intergenic
1136659707 16:31746742-31746764 CAGGTACTCCAATCAATCGTAGG + Intronic
1136735839 16:32466863-32466885 CAGGTACACCAATTAGTCTTAGG + Intergenic
1137083620 16:36096540-36096562 CAGGTACACCAATCAGACATAGG + Intergenic
1137296480 16:47098541-47098563 CAGGTACACCAGTCAAACGTAGG - Intronic
1137324857 16:47424056-47424078 CAGGTACACCAATCAAACGTAGG + Intronic
1137336326 16:47553161-47553183 CAGGTACACCAACCAAACATAGG + Intronic
1137828261 16:51518294-51518316 CAGGTACACCAATCAAATGTAGG - Intergenic
1137852467 16:51759885-51759907 CAGGAAAAGCAATAAAATGTGGG - Intergenic
1138151699 16:54663179-54663201 CAGGTACACCAGTCAAATGTAGG - Intergenic
1138706315 16:58919297-58919319 CAGGTACACCAATCAAACGTAGG + Intergenic
1138887077 16:61092276-61092298 CAGGTACACCAATCAAACAGAGG - Intergenic
1140165405 16:72545050-72545072 CAGGTACACCAATCAAACGTAGG - Intergenic
1141245960 16:82308037-82308059 CAGGTACACCAATCAAATGAAGG + Intergenic
1141333925 16:83137420-83137442 CACGCACATCAAATAAATGTTGG - Intronic
1203017236 16_KI270728v1_random:362711-362733 CAGGTACACCAATTAGTCTTAGG - Intergenic
1203035571 16_KI270728v1_random:635869-635891 CAGGTACACCAATTAGTCTTAGG - Intergenic
1144371918 17:14599279-14599301 CAGGTACACCAATCAAGCATAGG - Intergenic
1145690818 17:26737215-26737237 CAGGTACACCAATCAGACGTAGG - Intergenic
1146742994 17:35302668-35302690 CAGGTACACAAATCAAATGTAGG - Intergenic
1146746172 17:35332557-35332579 CAGGTACACCAATCAAATGTAGG + Intergenic
1146758896 17:35458390-35458412 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1146825782 17:36022159-36022181 CAGGTACACAAATCAAATGTAGG + Intergenic
1147525419 17:41217652-41217674 CAGGTACACCAATCAAACATAGG - Intronic
1147902362 17:43797112-43797134 CGGGTACACCAATCAGACGTAGG + Intergenic
1148967547 17:51448502-51448524 CAGGTACACCAATCAAATGTTGG - Intergenic
1149168464 17:53781501-53781523 CAGGTACACCAATCAATCATAGG - Intergenic
1149281116 17:55107063-55107085 CAGGTACACCAATCAAACATAGG + Intronic
1149352050 17:55800201-55800223 CAGGTACACCAATCAAATGGGGG + Intronic
1149365602 17:55940491-55940513 CAGGTACACCAATCAAATGTGGG - Intergenic
1150884763 17:69072109-69072131 CAGGTACACCAATAAAATGTAGG - Intergenic
1152500157 17:80702752-80702774 CAGGGACACCAATAAAATTAAGG - Intronic
1152953850 18:18652-18674 CAGGTACACCAATTAGTGTTAGG - Intergenic
1153702786 18:7712883-7712905 CAGGTACACCAATCAAACATAGG - Intronic
1153717698 18:7867823-7867845 CAGGTACACCAATCAAGCATAGG + Intronic
1153798614 18:8648243-8648265 CAGCTACACCAATCAAACGCAGG - Intergenic
1154039572 18:10840926-10840948 CAGGCACACTAGTTAGATGTGGG + Intronic
1155857184 18:30848894-30848916 CAGGTACACCAATCAGATGTAGG + Intergenic
1156166594 18:34428633-34428655 CAGGTACACCAATCAAACATAGG + Intergenic
1156230596 18:35150815-35150837 CAGGTACTCCAGTCAATTGTAGG + Intergenic
1156414992 18:36878641-36878663 CAGGTACACCAATCAAATGTAGG + Intronic
1156582504 18:38394087-38394109 CACGTACACCAATCAATAGTAGG - Intergenic
1156626725 18:38918880-38918902 CAGGTACACTAATCAAACGTAGG + Intergenic
1157067147 18:44365611-44365633 CAGGTACACCAATCAAATGTAGG + Intergenic
1157178704 18:45476608-45476630 CAGGTACACCAGTCAAACGTAGG + Intronic
1158297524 18:56015181-56015203 CAGGTACACCAGTCAAATGTAGG + Intergenic
1158398886 18:57103082-57103104 CAGGTACACCAATCAAACGTAGG + Intergenic
1158676831 18:59528105-59528127 CAGGTACCCCAATCAGTTGTAGG + Intronic
1158729014 18:60002628-60002650 CAGGTATTCCAATCAAATATAGG + Intergenic
1158853522 18:61519135-61519157 CAGGTACAACAAACAAATGTAGG - Intronic
1159155762 18:64579648-64579670 CAGGTACTCCAATCAACCGTAGG - Intergenic
1159254871 18:65932450-65932472 CAGGTACACCAATCAAATGTAGG - Intergenic
1159562352 18:70008773-70008795 CAGGTACACCAGTCAAACATAGG - Intronic
1159569486 18:70095921-70095943 CAGGTACATCAATCAAACGTAGG + Intronic
1159581484 18:70238232-70238254 CAGGTACACCAATCAAACATAGG - Intergenic
1159592202 18:70347576-70347598 CAGGTACACCAATCAGATGTAGG + Intronic
1159661084 18:71096751-71096773 CACGTACAGCAATCAAACGTAGG + Intergenic
1159901925 18:74054774-74054796 CAGGTACACCAATCAAGCATAGG - Intergenic
1164047336 19:21553952-21553974 CAGGTACACCAATCAATCATAGG + Intronic
1164127185 19:22329174-22329196 GAGTTACACCAATTACCTGTTGG - Intergenic
1164328933 19:24232732-24232754 CAGGTACACTAATCAGACGTGGG - Intergenic
1165254445 19:34566840-34566862 CAGGTACACCAAACAAACGTAGG + Intergenic
1165720946 19:38079394-38079416 TAGGTCCACCACTCAAATGTTGG - Intronic
1166263332 19:41658545-41658567 AAGGTACACCAATCAAACATAGG - Intronic
1167346316 19:48947627-48947649 CAGTTTCACCAGTTAAGTGTAGG + Intergenic
1168488730 19:56788775-56788797 CAGGTACACCAATCAAACGTAGG + Intronic
1168530699 19:57126385-57126407 CAGGTATACCAATCAATCGTAGG + Intronic
1202670467 1_KI270709v1_random:45299-45321 CAGGTACACCAATCAGACGTAGG - Intergenic
925087746 2:1123845-1123867 CAAGTAAACCAATTAAAAATGGG + Intronic
925245156 2:2376056-2376078 CAGGTACACCAATCAAACGTAGG + Intergenic
925447340 2:3939498-3939520 CTGGTACTCCAATCAATTGTAGG + Intergenic
925467411 2:4119648-4119670 CAGGTACACCAATCAAACGTAGG + Intergenic
925484350 2:4311994-4312016 CAGGTACACCAATGACACGTAGG + Intergenic
926483292 2:13426419-13426441 CAGGTACACCAATCAATCATAGG + Intergenic
926533693 2:14083599-14083621 CAGGTACACCAAACAAATATAGG - Intergenic
926970488 2:18462842-18462864 CAGGTACACCAATCAAACATAGG + Intergenic
928488431 2:31755869-31755891 CAGGAACACCAATCAAACGTAGG - Intergenic
928750812 2:34468024-34468046 CAGGTACACCAATCAAATGTAGG - Intergenic
928880331 2:36089906-36089928 CAGGTACACCAGTCAATCGTAGG - Intergenic
929064597 2:37961316-37961338 CAGGTACACCAATCAAACGTAGG + Intronic
929257582 2:39829602-39829624 CAGGTACACCATTGAAACGTAGG + Intergenic
929333369 2:40711550-40711572 CAGGTACACCAATCAAACATAGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930359480 2:50359621-50359643 CAGGTAGACCAATCAAATGTAGG - Intronic
930440046 2:51393004-51393026 CAGATACACTAATCAAATGTGGG - Intergenic
930476882 2:51892830-51892852 CAGGTCCACCAATCAAACATAGG - Intergenic
930545927 2:52767003-52767025 CAGGTACTCCAATCAATTGTAGG - Intergenic
930671642 2:54157979-54158001 CAGGAAAACCAACTAAAAGTTGG + Intronic
930838061 2:55815515-55815537 CAGGTACACCAATCAGATGTAGG - Intergenic
930925944 2:56817965-56817987 CAGGTACACCAATCAATCGTAGG - Intergenic
930951480 2:57148071-57148093 CAGGTACTCCAATTAGTTGTAGG - Intergenic
931030531 2:58169917-58169939 CAGGCACACCAATCAAACATAGG - Intronic
931030874 2:58173150-58173172 CAGGTACACAAATCAGACGTAGG - Intronic
931074115 2:58690007-58690029 AAGGTACACCAATCAAACATAGG - Intergenic
931211944 2:60205966-60205988 CAGGTACACCAATCAAACGTAGG + Intergenic
931478982 2:62621033-62621055 CAGGTACACCAGTCAGATGTAGG + Intergenic
931556136 2:63507948-63507970 CAGGTACACCAATCAAATGTAGG - Intronic
931814990 2:65891471-65891493 CAGGTACACCAGTCAAATGTAGG - Intergenic
931886558 2:66624615-66624637 CAAGTACACCAATAAAATGTAGG + Intergenic
932051967 2:68406711-68406733 CAGGTACACCAATCAAACATAGG - Intergenic
932543271 2:72679462-72679484 AAGGTAAACCAAAGAAATGTGGG + Intronic
933166489 2:79082381-79082403 CAGGTACACCAATCAAACGTAGG + Intergenic
933318047 2:80738343-80738365 CAGGTACACCAATCAATTGTAGG - Intergenic
933488125 2:82949201-82949223 CAGGTACACCAATCAAATGTAGG + Intergenic
933602380 2:84346677-84346699 CAGGTACTCCAATCAATTGTAGG + Intergenic
934177608 2:89590464-89590486 CAGGTACACCAATTAATCTTAGG + Intergenic
934187003 2:89755974-89755996 CAGGTACACCAATTAGTCTTAGG + Intergenic
934250963 2:90354973-90354995 CAGCTACACCAATCAGACGTAGG + Intergenic
934258600 2:91448437-91448459 CAGCTACACCAATCAGACGTAGG - Intergenic
934287907 2:91664765-91664787 CAGGTACACCAATTAATCTTAGG + Intergenic
934309987 2:91853200-91853222 CAGGTACACCAATTAGTCTTAGG - Intergenic
934478966 2:94617577-94617599 CAGGTACCCCAATCAGTTGTAGG + Intergenic
934698755 2:96421557-96421579 CAGGGACCCCAATCAACTGTAGG + Intergenic
935567807 2:104628322-104628344 CAGGTACACCAATCAAACATAGG + Intergenic
935961643 2:108430951-108430973 AAAGTACACCAATCAAACGTAGG - Intergenic
936694858 2:114934044-114934066 CAAGTTCACCATTAAAATGTAGG + Intronic
936769382 2:115893704-115893726 CAGGTACACCAATCAAACGTAGG + Intergenic
936807906 2:116359379-116359401 CAGGTACACCAATCAAATGTAGG - Intergenic
937143297 2:119620104-119620126 TAGGTACACCAGTCAAACGTAGG - Intronic
937562860 2:123246246-123246268 CGGGTACACCAATCAATTGCAGG - Intergenic
937762533 2:125622942-125622964 CAGATACACCAATCAAACGTAGG - Intergenic
938144895 2:128825201-128825223 CATGTACACTGATCAAATGTAGG - Intergenic
938549179 2:132364279-132364301 CAGGTACTCCAATCAATAGTAGG - Intergenic
938567958 2:132537671-132537693 CAGGTACACCAATCAATCGTAGG + Intronic
938952161 2:136265379-136265401 CAGGTGCACCAATAAAACATAGG + Intergenic
938975195 2:136470210-136470232 CAGGTACACCAATCAAACATAGG - Intergenic
939033424 2:137102900-137102922 CAGATACACCAATCAAATGTAGG - Intronic
939116753 2:138069964-138069986 TAGATACACCAATCAAACGTAGG + Intergenic
939180542 2:138797455-138797477 CAGGTACATTAATCAAACGTAGG - Intergenic
939247983 2:139649643-139649665 CAGGTACACCAATCTATTGTAGG - Intergenic
939374176 2:141342736-141342758 CAGGTACACCATTCCAATGTAGG - Intronic
939381882 2:141447039-141447061 CAGGTATGCCAATCAAATGTAGG + Intronic
939398510 2:141661694-141661716 CAGGTACCCCAGTCAACTGTAGG - Intronic
939544955 2:143541005-143541027 CAGGTACACCTATCAAATGTAGG + Intronic
939640689 2:144637298-144637320 CAGGTACACCAATCAAATGTTGG + Intergenic
939686992 2:145212453-145212475 CAAGTACACCAATCAAAGGTAGG + Intergenic
939876543 2:147585084-147585106 CAGGTACACCAATCAAACATAGG + Intergenic
939937607 2:148312277-148312299 CAGGTACACCAATCAAACGCAGG + Intronic
939942209 2:148363859-148363881 CAGGTACACCAATCAAACACAGG - Intronic
940030399 2:149256267-149256289 CAGGTACACCAATCAAATGTAGG + Intergenic
940054396 2:149498842-149498864 CAGGTACACCTATCAAATGTAGG + Intergenic
940096234 2:149979026-149979048 CAAGTATGCCAATTAAATGTAGG - Intergenic
940114568 2:150193688-150193710 CAGGTACACCAATCAAACATAGG - Intergenic
940407942 2:153327420-153327442 CAGGTACACCAGTGAAACGTAGG + Intergenic
940475127 2:154152559-154152581 CAGGTACACCAATCAAACGTAGG + Intronic
940564993 2:155350137-155350159 AAGGTACACCAATCAATCGTAGG + Intergenic
940602750 2:155881721-155881743 CAGGTACACCAGTCAAATGTAGG - Intergenic
940615989 2:156048961-156048983 CAGGTACTCCAATCAGTTGTAGG - Intergenic
940821556 2:158361188-158361210 CAGGTATACCTATCAAACGTAGG - Intronic
940925321 2:159357485-159357507 CAGGTACACTAATCAAACATAGG - Intronic
940934435 2:159475181-159475203 CAGGTGCACCAATCAAACATAGG + Intronic
940946672 2:159625193-159625215 CAGGCACACCAGTCAAATGTAGG - Intergenic
940999174 2:160182506-160182528 CAGGTACACCAATCAAACATAGG - Intronic
941088392 2:161145950-161145972 CAGGTACTCCAATCAATCGTAGG + Intronic
941114870 2:161461025-161461047 CAGGTGCACCAATCAAACGTAGG + Intronic
941149106 2:161891423-161891445 CAGGTACACCAATCAAACGTAGG + Intronic
941239239 2:163016242-163016264 CAAGTACACCATTCAATTGTAGG + Intergenic
941276743 2:163499179-163499201 CAGGTACACCAATCAAATTTAGG - Intergenic
941425998 2:165346334-165346356 CAGGTACACCAATCAAACTTAGG + Intronic
941518560 2:166510203-166510225 CCGGTACACCAATCAATCGTAGG + Intergenic
941590096 2:167409378-167409400 CAGGTACGCCAATTAATCATAGG + Intergenic
941682176 2:168411670-168411692 CAGGTACTCTAATCAAATGTAGG + Intergenic
942407371 2:175669829-175669851 CAGGTACACCAATCAAACATAGG - Intergenic
942411200 2:175710627-175710649 CAGGTACATCAATCAATTGTAGG - Intergenic
942431144 2:175912926-175912948 CAGGTACAGCAGTCAAACGTAGG + Intergenic
942732741 2:179077412-179077434 CAGGTATACCAGTCAAACGTAGG - Intergenic
942898917 2:181090735-181090757 CAGGTACACCAATCAAACGTAGG - Intergenic
942953532 2:181749173-181749195 CAGGTACACCAATCAAATGTAGG + Intergenic
943001337 2:182331976-182331998 CAAGTACACCAATCAAACGTAGG + Intronic
943047501 2:182875985-182876007 CAGGTACACCAATCAAACGTAGG - Intergenic
943074496 2:183178176-183178198 CAGGTACACCAATCAATCGTAGG + Intergenic
943095037 2:183418133-183418155 CAGGTACACCAATCAATTATAGG - Intergenic
943105899 2:183545102-183545124 CAGGTACACCATTCAAACATAGG - Intergenic
943130115 2:183843391-183843413 CAGGTACACCAAACAAATGTAGG - Intergenic
943352634 2:186813376-186813398 CAGGTACACCAATAAAATGTAGG - Intergenic
943359499 2:186900738-186900760 CAGGTACACCAATCAAATGTAGG + Intergenic
943409950 2:187534082-187534104 CAAGTACACCAATCAAATGTGGG - Intronic
943836983 2:192525991-192526013 CAGGTACACCAATCAATCGTAGG - Intergenic
943891743 2:193296323-193296345 CAGGTACACCAATCAAATGTAGG - Intergenic
944275273 2:197830535-197830557 CAGGTACACCAATCAAATATAGG - Intronic
944292196 2:198019751-198019773 CAGATACACCAATCAAATGTAGG - Intronic
944455358 2:199888096-199888118 CAGGTACATCAATCAAATGTAGG - Intergenic
945131979 2:206583486-206583508 CAGGTACACCAATTATTCTTTGG + Intronic
945207384 2:207345963-207345985 CAGGTACACCAATCAAACGTAGG - Intergenic
945210724 2:207379818-207379840 CAGGTACACCAATCAATCATAGG + Intergenic
945389150 2:209242943-209242965 CAGGTACACTAATCAAACATAGG - Intergenic
945409341 2:209489806-209489828 CAGATACACCAATCAATTGTAGG - Intronic
945481422 2:210350167-210350189 CAGGTACACCAATCAATCTTAGG + Intergenic
945487592 2:210416036-210416058 CAGGGACACCAATGAGTTGTAGG + Intergenic
945536418 2:211023998-211024020 CAGGTACACCAATTATTCTTAGG + Intergenic
945666867 2:212754290-212754312 CAGGTACACCAATCAAACATAGG - Intergenic
945852164 2:215021787-215021809 TAGTTATAGCAATTAAATGTTGG + Intronic
945927561 2:215820843-215820865 CAGGTACACCAATCAAATGTAGG - Intergenic
946065165 2:216981333-216981355 CAGGTACACCAATCAAACATAGG + Intergenic
946913153 2:224486631-224486653 CAGGTACACCAGTCAAACGTAGG - Intronic
947033657 2:225826089-225826111 CAGGTACTCCAATTAATTCTAGG - Intergenic
947225698 2:227838309-227838331 CAGGTACACCAATCAAACGTAGG + Intergenic
947483716 2:230526938-230526960 CAGGTACACTAATCAAACGTAGG - Intronic
947681262 2:232036146-232036168 CAGGTACATCAATCAAACGTAGG + Intronic
947907723 2:233777774-233777796 TAGGTACAACAATGAAATATTGG - Intronic
1168921897 20:1545241-1545263 TAGGTACACCAATCAAACGTAGG + Intronic
1169176797 20:3523430-3523452 CAGGTACACCAATCAAACGCAGG - Intronic
1169319889 20:4623944-4623966 CAGGCACACCAATCAAACGTAGG + Intergenic
1169396894 20:5240368-5240390 CAGGTACACCAATCAAACATAGG + Intergenic
1169606027 20:7320172-7320194 CAAGTATACCAATCAAATGTAGG - Intergenic
1169646113 20:7811781-7811803 CAGGTACACCAATCAAACATAGG + Intergenic
1169960191 20:11151411-11151433 CAGGTACACCAATCAAACGTAGG + Intergenic
1170134077 20:13053903-13053925 CAGGTACATCAATCAAATGTAGG - Intronic
1170167730 20:13379703-13379725 CAGGTACACCAATCAAACATAGG + Intergenic
1170229237 20:14027085-14027107 CAGGTACACCAATCAAACGTAGG + Intronic
1170266236 20:14469553-14469575 CAGGTACACCAATCAGTTGTAGG + Intronic
1170283211 20:14675067-14675089 CAGGTACACCAATCAAAAGTAGG - Intronic
1170294391 20:14807957-14807979 CAGGTACACCAATCAATCGTAGG - Intronic
1170454763 20:16521533-16521555 GAGGTACACCAATCAAACATAGG - Intronic
1170496746 20:16932138-16932160 CAGGTACTCCAATCAATCGTAGG - Intergenic
1170720298 20:18872027-18872049 CTGGTACACCAATCAAATGTAGG + Intergenic
1170727175 20:18940478-18940500 CAGGTACACCAATCAAACATAGG + Intergenic
1171001010 20:21415350-21415372 CAGGTACACCAATCCAACGTAGG - Intergenic
1171132661 20:22668140-22668162 GAGTTCCACCAATTAAATGTGGG + Intergenic
1171397761 20:24849303-24849325 CAGGTACTCCAATCAATTGTAGG + Intergenic
1171791230 20:29527273-29527295 CAGGTACACCAATCAGACGTAGG - Intergenic
1173751003 20:45476799-45476821 CAGGTACATCAATCAAACATAGG + Intronic
1175041102 20:56051375-56051397 CAGGTACACCAATCAAACGTAGG - Intergenic
1177042534 21:16131826-16131848 CAAGGACACCAATAAAATGTAGG + Intergenic
1177050428 21:16226122-16226144 CAGGTACGTCAATCAAACGTAGG - Intergenic
1177092140 21:16782430-16782452 CAGGTACACCAATCAAATGTAGG - Intergenic
1177129821 21:17242010-17242032 CAGGTACACCAATCAAATGCAGG - Intergenic
1177184030 21:17774374-17774396 CAGGTACACCAATCAAATGTAGG + Intergenic
1177249646 21:18576160-18576182 CAGGAACACCAATTATTTTTAGG + Intergenic
1177313372 21:19425672-19425694 CGGGTACAGCAATCAAACGTAGG - Intergenic
1177511213 21:22090645-22090667 CAGGTACTCCAATCAATCGTAGG + Intergenic
1177511976 21:22099204-22099226 CAAGTAACCCAATTAAAAGTAGG + Intergenic
1177527659 21:22316340-22316362 CAAGTACATCAATTAAATATTGG + Intergenic
1177763918 21:25434970-25434992 CAGGTACACCAATCAAACACAGG - Intergenic
1177912578 21:27050905-27050927 CTGGTACTCCAATCAATTGTAGG + Intergenic
1177943242 21:27436597-27436619 CAGGTACACCAATCAATCATAGG + Intergenic
1178393716 21:32220994-32221016 CAGGTACACCAATCAAACGTAGG - Intergenic
1178864284 21:36315295-36315317 CAGGTACACCAATCAAACGTAGG + Intergenic
1179066334 21:38028217-38028239 CAGTAAAACCAATTAAATGGTGG - Intronic
1180250219 21:46581071-46581093 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1182870460 22:33641895-33641917 CAGGTACACCAATAAAATGTAGG - Intronic
1183021331 22:35029568-35029590 CAGGTACACCAATCAAACATAGG + Intergenic
1183182566 22:36270554-36270576 CAGGTACACCAATCAATTGTAGG + Intergenic
1203236153 22_KI270732v1_random:3228-3250 CAGGTACCCCAATCAGACGTAGG - Intergenic
949175900 3:1062412-1062434 CAGGTACACCAATCAAATGTAGG + Intergenic
949222553 3:1653204-1653226 CAGGTACACCAATCAATCATAGG + Intergenic
949222655 3:1654451-1654473 CAGGTACACCAGTTAATCGTAGG - Intergenic
949377814 3:3409084-3409106 CAGGTGCACCAGTCAAATGTAGG - Intergenic
949423373 3:3890225-3890247 CAGGTACACCAAGCAAATGTAGG + Intronic
949440299 3:4072848-4072870 CAGGTACACCAGTCAAACGTAGG - Intronic
949453464 3:4212925-4212947 CAGGTACACCAATCAAACACAGG - Intronic
949532224 3:4967268-4967290 CAGGTACACCAATCAAATGTAGG - Intergenic
949580446 3:5382918-5382940 CAGGTACACCAATCAAATGTAGG + Intergenic
949583516 3:5414033-5414055 CAGGTACAGCAATCAAATGTAGG - Intergenic
949955208 3:9261713-9261735 CAGGTACACCAATCAAACGTAGG - Intronic
950597071 3:13994331-13994353 CAGGTACACCAATCAGATGTAGG + Intronic
950925066 3:16732182-16732204 CAGTTACACCAATCAAACGTAGG - Intergenic
950992183 3:17450748-17450770 CAGGTATACCAATCAAACGTAGG - Intronic
951137402 3:19119446-19119468 CAGGTACTCCAATCAATTGTAGG - Intergenic
951198024 3:19846004-19846026 CAGGTACATCAATCAAATGTAGG + Intergenic
951237563 3:20253310-20253332 CAGGTACACCGATCAAATGCAGG + Intergenic
951254341 3:20431745-20431767 CAGGTACACCAATCAAATGTAGG + Intergenic
951311054 3:21126377-21126399 CAGGTACACTAATCAAACGTAGG - Intergenic
951347074 3:21559788-21559810 GAGGTACACCAATCAAACGTAGG + Intronic
951414981 3:22413184-22413206 CAGGTACACCAATCAATCATAGG + Intergenic
951503504 3:23416677-23416699 CAGGTACACCAACCAAACGTTGG + Intronic
951628957 3:24698094-24698116 CAGGTACACCAATCAAACATAGG + Intergenic
951676284 3:25245946-25245968 CAGTTATACCAATCAAACGTGGG + Intronic
951687446 3:25361106-25361128 CAGGTACACCAATCAAACGTAGG + Intronic
951795340 3:26532626-26532648 CAGGTCCACCAATCAAATGTCGG + Intergenic
951832343 3:26944366-26944388 CAGGCACACCAATCAATTGTAGG - Intergenic
951951577 3:28204215-28204237 CAGGTACTCCAATCAATTGTAGG - Intergenic
952607827 3:35171583-35171605 CAGGTACTCCAATCAATTATAGG + Intergenic
952679279 3:36072914-36072936 CAGGTACCCCAATCAGTTGTAGG + Intergenic
952718664 3:36509530-36509552 CAGGTACACCAATCAAATGTAGG + Intronic
952842441 3:37659305-37659327 CAGATACACCAATCAAATGTAGG + Intronic
953074210 3:39552716-39552738 CAGGTACACCAATCAAACATAGG - Intergenic
953102187 3:39841088-39841110 CAGGTACACCAATCAAATGTAGG + Intronic
953115482 3:39988638-39988660 CAGGTACTCCAATCAATTGTAGG + Intronic
953264423 3:41372158-41372180 CAGGTACACCAATCAAATGTAGG - Intronic
953433509 3:42859039-42859061 CAGGTACACCAATCAAACGTAGG - Intronic
954508038 3:51096262-51096284 CAGGTACACCAATCAAACATAGG + Intronic
954510354 3:51119593-51119615 CATATACACCAATCAAATGTAGG + Intronic
954524231 3:51255495-51255517 CAGGTACACCAATCAAATGTAGG + Intronic
954525112 3:51262933-51262955 CAGGTACACCAATCAAACATAGG - Intronic
955439895 3:58944087-58944109 CAGGTATACCAATCAAATGTAGG - Intronic
955447965 3:59033713-59033735 CAGGTACACCAATCAAACATAGG - Intronic
955644381 3:61121108-61121130 CAGGTACACCAATCAGTTGTAGG - Intronic
955657671 3:61262444-61262466 CAGGTACTCCAATCAAATGTAGG + Intergenic
956005972 3:64778306-64778328 CATGTATACCAATCAAATGTAGG - Intergenic
956157185 3:66311119-66311141 CGGGTACACCAATCAATCGTAGG + Intronic
956207521 3:66770135-66770157 CAGGTACACAAATCAAATGTAGG + Intergenic
956264480 3:67381527-67381549 CAGTAGCACCATTTAAATGTGGG - Intronic
956279515 3:67541529-67541551 CAGGTACACCAATCAAACGTAGG - Intronic
956300200 3:67764130-67764152 CAGGTACACCAATCCAATGTAGG + Intergenic
956301757 3:67780219-67780241 CAGGTACACCAATCAAATGTAGG + Intergenic
956369472 3:68542800-68542822 CAAATACACCATTTACATGTGGG + Intronic
957008921 3:74983299-74983321 CAGGTACACCAATCAATCATAGG + Intergenic
957011117 3:75007511-75007533 TAGGTACACCAATCAAATGTAGG + Intergenic
957102816 3:75849623-75849645 CAGGTACACCAATTAGATGTAGG + Intergenic
957256465 3:77844002-77844024 CAGGTACACCAATCAAACATAGG + Intergenic
957268732 3:78002150-78002172 CTGGTACTCCAATCAATTGTAGG + Intergenic
957311027 3:78519107-78519129 TAGGATCACCAATTAATTGTAGG + Intergenic
957331508 3:78770201-78770223 CAGGTACACCAATTATTCTTAGG + Intronic
957394879 3:79623710-79623732 CTGGTACTCCAATCAATTGTAGG - Intronic
957596456 3:82273030-82273052 CAGGTACACCAATCAAACGTAGG + Intergenic
957776653 3:84762525-84762547 CAGGGATACCAATCAAATGTAGG - Intergenic
957811467 3:85228252-85228274 CAGGTACACCAATCAAATGTAGG + Intronic
957871442 3:86094459-86094481 CAGGTACACCAGTCAGATATAGG - Intergenic
957930792 3:86875787-86875809 CAGGTACACCAATCAAACATAGG + Intergenic
957993097 3:87652494-87652516 CAGGTACACCAATCAAATGTAGG + Intergenic
958073094 3:88640017-88640039 CTGGTACTCCAATCAATTGTAGG + Intergenic
958200748 3:90311707-90311729 CAGGTAAACCAATGAGATGTAGG + Intergenic
958261107 3:91382379-91382401 CAGGTACACCAATCAAACATAGG + Intergenic
958481795 3:94653090-94653112 CAGGTATTCCAATCAATTGTAGG + Intergenic
958520771 3:95183377-95183399 CATGTACACCAATCAAACATAGG + Intergenic
958586394 3:96092688-96092710 CAGGTACACCAGTCAAACCTAGG - Intergenic
958694417 3:97509814-97509836 CAGGTACACAAATTAAACATAGG + Intronic
958793733 3:98683385-98683407 CAGGCACACCAGTAAAACGTAGG - Intergenic
959025803 3:101238233-101238255 CAGGTACACCAATCAAATGTAGG - Intronic
959092918 3:101923672-101923694 CAGGTACACCAATCAAACGTAGG + Intergenic
959292043 3:104486460-104486482 CAGGTACACCAATCACACATAGG - Intergenic
959354534 3:105308921-105308943 CAGGTACACCAATCAAATGTAGG + Intergenic
959423062 3:106151436-106151458 CAGCTACACCATCCAAATGTAGG + Intergenic
959453916 3:106535553-106535575 CAGGTACACCAATCAATCATAGG - Intergenic
959479515 3:106854398-106854420 CAGGTACACCAATCAATCGTAGG - Intergenic
959506072 3:107157510-107157532 CAGGTACACCAATCAATCATAGG - Intergenic
959534754 3:107471876-107471898 CAGGTACACCAATCAAATGTAGG - Intergenic
959694628 3:109235680-109235702 CAGGTACTCCAATCAGACGTAGG - Intergenic
959735131 3:109649408-109649430 CAGGTACACCAATCAAATGTAGG - Intergenic
959801150 3:110496542-110496564 CAGGTACACAAATCAAATGTAGG - Intergenic
959828853 3:110835474-110835496 CAGGTACACCAATCAATCATAGG + Intergenic
959843027 3:111000122-111000144 CAGGTACACCAATCAAAGGTAGG - Intergenic
959881055 3:111445731-111445753 CAGGTATACAAATCAAATGGAGG + Intronic
960177443 3:114533503-114533525 CAGGTACACCAATGAAACGTAGG - Intronic
960226753 3:115178235-115178257 CATGTACACCAATCAAACATAGG + Intergenic
960477114 3:118143909-118143931 CTGGTACTCCAATCAATTGTAGG + Intergenic
960502858 3:118458230-118458252 CAGGTACAACAATCAAATGTAGG - Intergenic
960680002 3:120237942-120237964 CAGGTACTCCAATCAGTTGTAGG + Intronic
960759950 3:121062635-121062657 CAGGTACACCAGTTAAACATAGG + Intronic
960768802 3:121168704-121168726 TAGGTACACCAATCAAACATAGG - Intronic
960773005 3:121215830-121215852 CAAGTACACCAATCAAACATAGG + Intronic
960776665 3:121263826-121263848 CAGGTACACCAATCAAACATAGG - Intronic
961956172 3:130806129-130806151 CAGGTACACCAATCAGACGTAGG - Intergenic
961998087 3:131267900-131267922 CAGGTACACCAATCAAACATAGG + Intronic
962064537 3:131964737-131964759 CAGATACACCAATCAATTGTAGG - Intronic
962124995 3:132607638-132607660 CAGGTACACCAGTCAAACCTAGG - Intronic
962157019 3:132958237-132958259 CAGGTACACCAATCAAATGTAGG - Intergenic
962180943 3:133205926-133205948 CAGGTACACCAATCAAATATAGG + Intronic
962239122 3:133735819-133735841 CAGGTACACAAATCAAATGTAGG - Intergenic
962639988 3:137375927-137375949 CAGGTACATCAATCAAACATAGG + Intergenic
962642208 3:137399440-137399462 CAGGTGCACCAATCAAACATAGG + Intergenic
962656110 3:137545212-137545234 CAGGTACACCAATCAAACGTAGG - Intergenic
962666195 3:137655715-137655737 CAGGTACAACAATCAAACGTAGG - Intergenic
962666832 3:137662076-137662098 CAGGTACAACAATCAAACGTAGG - Intergenic
962998871 3:140657452-140657474 CAGGTGCTCCAATCAATTGTAGG - Intergenic
963013822 3:140801908-140801930 CAGGTACACTAATCAAATGTAGG + Intergenic
963027599 3:140934872-140934894 CAGGTATACCAATCAAATTTAGG - Intergenic
963551263 3:146726985-146727007 CAGGTACACCAGTCAAACGTAGG - Intergenic
963998406 3:151738621-151738643 CAGGTACACCAATCTAACGTAGG + Intronic
964010532 3:151886659-151886681 CAGGTACACCAATCAAATGTAGG - Intergenic
964049324 3:152371928-152371950 CAGGTACACCAGTCAAACATAGG + Intronic
964053248 3:152421132-152421154 GAGGTACACCAATCAAACGTAGG - Intronic
964232644 3:154488314-154488336 CAGGTACACCAATCAAACGTAGG - Intergenic
964371214 3:156002708-156002730 CAGGTACACCAGTCAAACGTAGG + Intergenic
964543230 3:157803150-157803172 TGGGTACATCAATCAAATGTAGG + Intergenic
964566834 3:158065910-158065932 CAGGTACACCAATCAAATGTAGG - Intergenic
965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG + Intergenic
965090924 3:164162043-164162065 CAGATACACCAATCAAACTTAGG + Intergenic
965228786 3:166025729-166025751 CAGGTACACCAATCAGACATAGG + Intergenic
965371304 3:167865017-167865039 CCAGTACAGCAATTAAAAGTAGG - Intergenic
965618577 3:170620266-170620288 CAGGTACACCAATCAAACGTAGG + Intronic
965880618 3:173383670-173383692 CAGGTACACCAATCAAACATAGG - Intergenic
965903823 3:173677820-173677842 TAGGTACAGCAATCAAATCTTGG + Intronic
966080731 3:175996989-175997011 CAGGTACCCCAATCAGTTGTAGG - Intergenic
966291338 3:178362627-178362649 CAGGTACACCAATCAAATGTAGG - Intergenic
966309581 3:178577891-178577913 CAGGTACACCAATCAAATGTAGG - Intronic
966533149 3:181003130-181003152 CAAGTACACCAATCAAACATAGG + Intergenic
966539485 3:181073976-181073998 CAGGTACTCCAATCAATTGTAGG + Intergenic
968696527 4:2032536-2032558 CAGGTACTCCAATCAGTTGTAGG + Intronic
969123237 4:4924946-4924968 CAGGTACACCAATAAAATGTAGG + Intergenic
969909035 4:10426736-10426758 CAGGTACACCAATCAAAAATAGG + Intergenic
969970871 4:11046878-11046900 CAGGTACACTAATCAAATGTAGG + Intergenic
970304829 4:14720244-14720266 CAGGTACACCAATCAAATGTAGG - Intergenic
970685393 4:18560944-18560966 CAGGCACACCAATCAAATGTAGG - Intergenic
970727325 4:19061658-19061680 CAGATACAGCATTCAAATGTAGG - Intergenic
971186601 4:24383740-24383762 CAGGTACAACAATCAAATGTAGG - Intergenic
971285878 4:25289722-25289744 CAGGTACCCCAATCAGTTGTAGG + Intergenic
971429904 4:26555136-26555158 CAGGTACACAAGTCAAATGTAGG + Intergenic
971476197 4:27074867-27074889 CAGGTACACCAATCAGACGTAGG + Intergenic
971589647 4:28450939-28450961 TAGCTACACCAATTACATATTGG + Intergenic
971673462 4:29594305-29594327 CAGGTACACCAATCAAACGTAGG + Intergenic
971679185 4:29674663-29674685 CAGGTACACCAGTCAAATGTAGG - Intergenic
971698037 4:29931343-29931365 CACGTACACCAGTCAAATGTAGG - Intergenic
971883397 4:32410853-32410875 CAGGTACACCAATCAAATATAGG - Intergenic
971988862 4:33865449-33865471 CAGGTACAGCAATCAAACTTAGG - Intergenic
972219470 4:36937134-36937156 CAGGCACACCAATCAAATGTAGG - Intergenic
972255726 4:37353472-37353494 CAGATACACCAATCAAACTTAGG + Intronic
972500499 4:39673651-39673673 CAGGTACACCAATCAAACGTAGG + Intergenic
972755720 4:42043582-42043604 CAGGTACACCAACCAAATGTGGG - Intronic
972861150 4:43170357-43170379 CAGGTACTCCAATAAGTTGTAGG - Intergenic
972962901 4:44475228-44475250 CAGGTACACCAATCAAATGTAGG - Intergenic
973070707 4:45855272-45855294 CAGGTACACTAATTATTTTTAGG + Intergenic
973273157 4:48281433-48281455 CAGGTACACCAATCAAACGGAGG - Intergenic
973321968 4:48818938-48818960 CAGGTACACCAATCAATTGTAGG - Intronic
973679762 4:53304455-53304477 GAGGTACACCAATCAACTGTAGG + Intronic
973715067 4:53668441-53668463 CAGTTACACCAATGAAACGTAGG + Intronic
974106039 4:57471092-57471114 CAGGTACACCAATCAAACATAGG + Intergenic
974182336 4:58400395-58400417 CAGGTACACCAATCAGACGTAGG + Intergenic
974263809 4:59559124-59559146 CAGGTACACAAATGAAATGTAGG + Intergenic
974271640 4:59657449-59657471 CTGGTACACCAATTAATCATAGG - Intergenic
974560226 4:63507473-63507495 CAGGTACATCAATCAATTGTAGG - Intergenic
974814108 4:66983251-66983273 CAGGTATAGCAATCAAATGTAGG - Intergenic
974851623 4:67411344-67411366 CAGGTACACCAATCAAACATAGG + Intergenic
974899583 4:67980969-67980991 CAGGTACCCCAATTAGTTGTAGG + Intergenic
975092687 4:70422536-70422558 CAGGTACACCAATCAGATGTAGG + Intergenic
975149253 4:71003580-71003602 CAGGTATACCAGTCAAACGTAGG + Intronic
975307868 4:72869385-72869407 CAGGTACACCAATCAAACATAGG - Intergenic
975466184 4:74712592-74712614 CAGGTACACCAATAAAACATGGG + Intergenic
975484031 4:74914821-74914843 CAGGTACACCAATCAAACGTAGG + Intergenic
975513847 4:75222832-75222854 CAGGTACACCAATCAAGTGTAGG - Intergenic
975518209 4:75270113-75270135 GAGATACATCAATCAAATGTAGG - Intergenic
975524395 4:75332819-75332841 CAGGTACATCAATCAAACGTAGG - Intergenic
975532901 4:75419550-75419572 CCGGTACACCAATCAAATGTAGG + Intergenic
975638946 4:76479495-76479517 CAGGTACACCAATCAAATGTAGG - Intronic
975764840 4:77656221-77656243 GAGGTACACCAATCAAATGTAGG - Intergenic
976156713 4:82153462-82153484 CAGGTATACCAGTCAATTGTAGG - Intergenic
976370951 4:84287444-84287466 CAGGTACACCAATCAAATGTAGG - Intergenic
976534186 4:86192399-86192421 CAGGTACATCAATCAAACATAGG + Intronic
976655767 4:87487721-87487743 CAGGTACACCAATCAGATGTAGG + Intronic
976669654 4:87637644-87637666 CAGGTACACCAATCAAGCATGGG - Intergenic
976698431 4:87942983-87943005 CAGGAACACCAATCAAACATAGG - Intergenic
976716093 4:88123679-88123701 CAGGTACACCAATAAAACGTAGG - Intronic
976809818 4:89088992-89089014 CAGGTACACCAATCAAATGTAGG + Intronic
976852733 4:89567211-89567233 CAGGTACGCTAATCAAACGTAGG + Intergenic
976996394 4:91438994-91439016 CAGGTACACCAATGAGACATAGG - Intronic
977047048 4:92080502-92080524 TAGGTACACCAATCAAATGTAGG - Intergenic
977154630 4:93556613-93556635 GAGGTACACCAGTCAAACGTAGG - Intronic
977185503 4:93931434-93931456 CAGGAACACCAATCAAATGTAGG + Intergenic
977425700 4:96864380-96864402 CAGGTACACCAATCAAATGTGGG - Intergenic
977632825 4:99262425-99262447 CAGGTACACCAATCAAATGTAGG + Intergenic
977774571 4:100901944-100901966 CAGGCACACCAATCAAATGTAGG - Intergenic
977793087 4:101130264-101130286 CAGGTACCCCAATCAAACATAGG - Intronic
977888034 4:102274465-102274487 CAGGTACACCAATCAAACGTAGG - Intronic
977897672 4:102382937-102382959 CAGGTACACCAATCAAACGTAGG + Intronic
978055065 4:104253458-104253480 CAGGTACACCAAGCAAATGTAGG - Intergenic
978078761 4:104566947-104566969 CAGGTACCCCAATCGAACGTAGG + Intergenic
978108435 4:104932075-104932097 CATGTACACCAATCAAATATAGG - Intergenic
978139224 4:105298565-105298587 CAGGTACACCAGTCAAACATAGG - Intergenic
978179387 4:105774983-105775005 CAGGTACACCAATCAAACTTAGG + Intronic
978269739 4:106874730-106874752 CTGGTACACCAATCAAACGTAGG + Intergenic
978278176 4:106977367-106977389 CAGGTACACCAATCAAATGTAGG + Intronic
978313417 4:107410790-107410812 CAGGTATACCAATCAAACATAGG - Intergenic
978477109 4:109143533-109143555 CAGGTACACCAATCAAACATAGG + Intronic
978601250 4:110430796-110430818 CAGGTACACCAATCAAATGTAGG + Intronic
978664448 4:111165551-111165573 CAGGTACACCAATCAAACGTAGG - Intergenic
978699611 4:111627076-111627098 CAGGTACACCAGTGAAATGTAGG + Intergenic
978893184 4:113853651-113853673 CAGGTACACTAATCAGACGTAGG - Intergenic
979006023 4:115298278-115298300 CAGGGACACCAATTGCATGGGGG - Intergenic
979012473 4:115388762-115388784 CAGGTATACCAATCAAATGTAGG - Intergenic
979043832 4:115835753-115835775 CAGGTACAGCAATCAAATGTAGG - Intergenic
979417606 4:120462241-120462263 CAGGTACACAAATCAAATGTAGG - Intergenic
979421548 4:120510621-120510643 CAGGTACACCAATCCAATGTAGG - Intergenic
979461466 4:120989318-120989340 CAGGTACACCAATCAAACACAGG + Intergenic
979554824 4:122033296-122033318 CAGGTACACCAATCAAACGTAGG + Intergenic
979588089 4:122444934-122444956 CAGGTACACCAATAAAATGTAGG + Intergenic
979629606 4:122885641-122885663 CAGGTGCACCAAACTAATGTAGG - Intronic
979698147 4:123637887-123637909 CAAGTACACTAATCAAATGTAGG + Intergenic
979735201 4:124074096-124074118 CTGGTACTCCAATCAATTGTAGG - Intergenic
979965821 4:127075959-127075981 CAGGTACACCAATCAAACGTAGG + Intergenic
980100166 4:128534515-128534537 CAGGTACACCAATCAAACGTAGG + Intergenic
980157478 4:129125151-129125173 CAGGTACACCAATCAAACGTAGG + Intergenic
980171135 4:129291560-129291582 CAGGTACAACAATCAAATGTAGG + Intergenic
980223155 4:129946585-129946607 TAAGTACACCAATCAAATGTAGG + Intergenic
980261834 4:130459137-130459159 CGGGTACACCAATCAAAGGTAGG + Intergenic
980392773 4:132168547-132168569 CTGGTACTCCAATCAATTGTAGG + Intergenic
980494028 4:133568942-133568964 CAGGTACACCAATCAATCGTAGG + Intergenic
980513341 4:133822361-133822383 CAGGTACACCAATCAAACATAGG + Intergenic
980633777 4:135472581-135472603 CAGGTACACCAATCAAACGTAGG + Intergenic
980861736 4:138507118-138507140 CAGGTACACCAATCAAACGTAGG + Intergenic
980887963 4:138784247-138784269 CAGGTACACCAATCAAATGTAGG + Intergenic
981133829 4:141188475-141188497 CAGGTACACCAACCAATCGTAGG + Intronic
981202027 4:141991644-141991666 CAGGTATACCAATCAAATGTAGG + Intergenic
981273329 4:142869227-142869249 CAGGTACACCAATCAAATGTAGG - Intergenic
981395943 4:144249112-144249134 CAGGTACAGCAATCAAACGTAGG + Intergenic
981411409 4:144436442-144436464 CAGGTACACCAATCAAACGTAGG - Intergenic
981481313 4:145242122-145242144 CAGGTACACCAATCAAATGTAGG + Intergenic
981789489 4:148520530-148520552 CAGGTACACCAATCAAATGTAGG + Intergenic
981824976 4:148929627-148929649 CAGGAACACCAATTATTTTTAGG - Intergenic
981846671 4:149177358-149177380 CAGGTACACCAATCAAATGTCGG - Intergenic
982060116 4:151596650-151596672 CAGGTACACCAATTAAACATAGG + Intronic
982298801 4:153858354-153858376 CAGGTACACCAATGAAACATAGG + Intergenic
982324038 4:154110295-154110317 CAGGTACACCAATCAAACGTAGG - Intergenic
982393780 4:154893474-154893496 CACGTACACCAATCAAAGGTAGG - Intergenic
982733567 4:158981219-158981241 CAGGTACACCAAGCAAACATAGG - Intronic
982794381 4:159628353-159628375 CAGGTACACAAATCAAATGTAGG + Intergenic
982825881 4:160003173-160003195 CAGGTACACCAATCAAATGTAGG - Intergenic
982909068 4:161116873-161116895 CAGGTACACCAACCAAACGTAGG + Intergenic
983047322 4:163003343-163003365 CAGGTACACCAATTAAACATAGG + Intergenic
983841006 4:172456715-172456737 CAGGTACACCAATCAAACATAGG - Intronic
983896074 4:173083453-173083475 CATGTACATCAATCAAACGTAGG + Intergenic
983949300 4:173621195-173621217 CAGGTACAGGAATCAAATGTAGG + Intergenic
983958656 4:173726569-173726591 CAGGTACACCAATCAAACATAGG + Intergenic
984008922 4:174347234-174347256 CAGGTACACCAATCAATCGTAGG + Intergenic
984215901 4:176912174-176912196 CAGGTACTCCAATCAATTGTAGG - Intergenic
984354346 4:178638498-178638520 CAGGTAAACCAATCAAATGTCGG - Intergenic
984493821 4:180469900-180469922 CAGGTACACCAATCAATCGTAGG - Intergenic
984618802 4:181928544-181928566 CAGGCACACCCATCAAACGTAGG - Intergenic
985204626 4:187521994-187522016 CAGGTACACCAATCAAACGTAGG - Intergenic
986484496 5:8221528-8221550 CAGGTACACCAATCAAACGTAGG - Intergenic
986648099 5:9938276-9938298 CAGGTACACCCATCAAATGCAGG - Intergenic
986675341 5:10179171-10179193 CAGGTACACCCATCAAATGTAGG - Intergenic
986725936 5:10596560-10596582 CAGGTACGCCAATCAGTTGTAGG - Intronic
986917487 5:12639867-12639889 CAGGTACACCAATCAAATGTAGG + Intergenic
986920373 5:12672895-12672917 CAGGTATAGCAATCAAATGTAGG + Intergenic
987019410 5:13853886-13853908 TAGGTACATCGATCAAATGTAGG - Intronic
987228908 5:15871800-15871822 CAGGTACATCAATCAAACGTTGG - Intronic
987260565 5:16197914-16197936 CAGGTACCCCAATCAGTTGTAGG - Intergenic
987656685 5:20816125-20816147 CAGGTACACCAATCAAACGTAGG - Intergenic
987834555 5:23145050-23145072 CTGGTACCCCAATCAATTGTAGG + Intergenic
987923932 5:24316594-24316616 CAGGTACACCAATCAAGTGTAGG + Intergenic
987957115 5:24754416-24754438 CAGGTACACAAATAAAATGTAGG + Intergenic
988289961 5:29271840-29271862 CAGGTACACCAATCAAACGTAGG - Intergenic
988627870 5:32897503-32897525 CAGGTACACCAATCAAATGGAGG + Intergenic
988766866 5:34387820-34387842 CAGGTACACCAATCAAACGTAGG + Intergenic
988867551 5:35352679-35352701 CAGGTACACCAATAAAACCTAGG + Intergenic
988970951 5:36466817-36466839 CAGGTACACCAGTCAATTGTAGG - Intergenic
989320558 5:40129677-40129699 CAGGTACACCATTCAAACATAGG + Intergenic
989364095 5:40635972-40635994 CAGGTACACCAATCAAACATAGG - Intergenic
989522338 5:42417042-42417064 CAGGTACACCAATAAGACGTAGG + Intergenic
989618891 5:43365786-43365808 CAGGTACACCAATCAAACATAGG + Intergenic
989766169 5:45086039-45086061 AAGGTACACCAATCAAATGTAGG - Intergenic
989968056 5:50488613-50488635 CAGGTACACCAATCAGATGTAGG + Intergenic
990163554 5:52970373-52970395 CAAGTACACCAATCAAACATAGG + Intergenic
990183624 5:53189990-53190012 CAGGTTCACCAATCAAACATAGG + Intergenic
990745696 5:58957714-58957736 TAGGTACACCAGTCAAATGTAGG + Intergenic
990803656 5:59633251-59633273 CAGGTACACTAATCACATGTAGG - Intronic
990897436 5:60714542-60714564 CAGGTACACCAATCAAATGTAGG + Intergenic
991025567 5:62025891-62025913 CAGATACACCAATCAAATGTAGG + Intergenic
991128285 5:63091820-63091842 CAGGTACACCAATCAAACATAGG - Intergenic
991150286 5:63359993-63360015 CAGGTATACCAGTGAAATGTAGG + Intergenic
991151617 5:63377331-63377353 CAGGTACACCAATCAAACATAGG - Intergenic
991223727 5:64244602-64244624 CAGGTACACCAATCAAATGTAGG - Intronic
991283087 5:64938733-64938755 CAGGTACACCAGTCAAACATAGG + Intronic
991397613 5:66221522-66221544 CAGATACACCAATCAAATGTAGG + Intergenic
991532496 5:67631339-67631361 CAGATACACCAATCAAACATAGG + Intergenic
991944907 5:71890556-71890578 CAGGCTCACCATCTAAATGTTGG + Intergenic
992038722 5:72807663-72807685 CAGGTACACCAATCAAATGTAGG + Intergenic
992055138 5:72981572-72981594 CAGGTACACCAATCAAATGTAGG + Intronic
992078023 5:73208587-73208609 CAGGTACACTAATCAAACATAGG - Intergenic
992287437 5:75249637-75249659 CAGGCACACCAATCAAACATAGG - Intergenic
992292188 5:75291253-75291275 CAGGTACACCAAACAAATGTAGG + Intergenic
992316816 5:75565008-75565030 TAGTTTCACCAATCAAATGTAGG + Intronic
992505914 5:77387703-77387725 CAGGTACACCAGTCAAATGTAGG + Intronic
992976740 5:82128986-82129008 CAAGTACACCAATCCAATGTAGG + Intronic
993068704 5:83132509-83132531 CAGGTACACCAATCAGACGTAGG + Intronic
993119292 5:83754967-83754989 CAGGTACACCAATCAAGTGTAGG - Intergenic
993252143 5:85542021-85542043 AAAGTACACCAATAAAAAGTAGG + Intergenic
993265631 5:85722825-85722847 CAGGTACACCAATCAAATGTAGG - Intergenic
993372731 5:87112643-87112665 CAGGTACACAATTTAAATGGAGG - Intergenic
993381707 5:87216518-87216540 CAGGTACATCAATTAAACATAGG + Intergenic
993404094 5:87489313-87489335 CAGGTACACCAATCAAACATAGG - Intergenic
993513270 5:88798265-88798287 TAGGTACACCAATCAAATGTAGG + Intronic
993541775 5:89160695-89160717 CAGGTACACTAATCAAATGTAGG - Intergenic
993587174 5:89745841-89745863 CAGGTACTTCAATTAATCGTAGG + Intergenic
993757480 5:91749840-91749862 CAGGTACACCAATCAAATGTAGG + Intergenic
993891838 5:93483964-93483986 CAGGTACACCAATCAAACATAGG - Intergenic
993895136 5:93524370-93524392 CAGATACACCAATCAAACGCAGG - Intergenic
993911708 5:93691541-93691563 CAGGTACACCAGTCAAACGCAGG - Intronic
993960820 5:94295047-94295069 CTGGTACACCAATCAAACGTAGG + Intronic
994005012 5:94827593-94827615 CAGGTACACCAATCAAATGTAGG + Intronic
994015191 5:94956782-94956804 CAGGTACACCAATCAAACGTAGG - Intronic
994142705 5:96359961-96359983 CAGGTACACCAATCAAACATAGG + Intergenic
994233380 5:97335027-97335049 CATGTATACCAATCAAATGTAGG + Intergenic
994344674 5:98670124-98670146 CAGGTACTCCAATCAATCGTAGG - Intergenic
994642113 5:102422638-102422660 CAGGTACACCAATCAATCATAGG - Intronic
994802431 5:104396278-104396300 CAGGTACACCAATCAATCATAGG - Intergenic
994917887 5:106003507-106003529 CAGGTACACCAATCAAACCTAGG + Intergenic
994978327 5:106840244-106840266 CACGTACACCAATCAAACATAGG - Intergenic
995188122 5:109292097-109292119 CAGGTACACCAATCAGTTGTAGG - Intergenic
995211034 5:109539500-109539522 CAGGTACACCAATCAAATGTAGG - Intergenic
995302058 5:110595789-110595811 CAGGTACACTAATCAGTTGTAGG - Intronic
995326070 5:110891680-110891702 CAGGTACACCAATCAAACGTAGG + Intergenic
995467409 5:112465362-112465384 CAGGTACACCATTCAGATGCAGG + Intergenic
995594042 5:113729839-113729861 CATGTACTCCAATCAATTGTAGG + Intergenic
995692787 5:114845909-114845931 CAGGTACACCAATCAGACATAGG - Intergenic
995815876 5:116167358-116167380 CAGGTACACCAATCAAACACAGG - Intronic
995983242 5:118133892-118133914 CCGGTACACCAATCAAACATAGG + Intergenic
996033031 5:118727941-118727963 CAGGTACACCAATCAAACGTAGG - Intergenic
996055238 5:118975152-118975174 CACGTACACCAATCAAACATAGG + Intronic
996242665 5:121222447-121222469 CAGGTACACCAATCAATTGTAGG - Intergenic
996270939 5:121603666-121603688 CAGGTACACCAATCAAACATAGG - Intergenic
996287569 5:121812656-121812678 CAGGTACTCCAATAAATTGTAGG + Intergenic
996427760 5:123333961-123333983 CAGGTACACCAATCAAACATAGG + Intergenic
996780113 5:127176435-127176457 CAGGAACACCAATTAATCTTAGG + Intergenic
996829857 5:127728057-127728079 CAGGTACCCCAATCAGTTGTAGG - Intergenic
996910727 5:128654596-128654618 CAGGTACACCAATCAAAAATAGG + Intronic
996953148 5:129152100-129152122 CAGGTACACCACTCAAACGTAGG + Intergenic
997069809 5:130608301-130608323 CAGGTACACCAATCAAATGTAGG - Intergenic
997097123 5:130925312-130925334 TAGGTACACCAGTCAAATGTAGG - Intergenic
997216801 5:132118220-132118242 CAGGTACACCAATCAAACATAGG - Intergenic
997217695 5:132128035-132128057 CAGGTACACCCATTAATTGTAGG + Intergenic
997220205 5:132156051-132156073 CAGATACACCAATCAAACGTAGG + Intergenic
997252454 5:132399596-132399618 CAGGTACACCAATCAAACCTAGG - Intergenic
997578518 5:135002591-135002613 CAGGTACACCAATCAGACATAGG + Intronic
997809371 5:136952677-136952699 CAGGTACAACAATCAAATATAGG + Intergenic
998644757 5:144049604-144049626 AAGGTACTCCAATCAATTGTAGG - Intergenic
998717872 5:144906595-144906617 CTGGTACACCAATCAAACATAGG - Intergenic
998919506 5:147052373-147052395 GAGGTACAACAGTTACATGTGGG + Intronic
998972622 5:147609804-147609826 CAGGTACACCAATCAAACATAGG + Intronic
999029916 5:148279910-148279932 CAAGTATACCAGTAAAATGTAGG + Intronic
999468811 5:151832663-151832685 CAGGTACACCAACTGAACGTAGG - Intronic
999488516 5:152025321-152025343 CAGGTACACCCATCAATTGTAGG + Intergenic
999489685 5:152037970-152037992 CAGGTACACCAATCAAACGTAGG + Intergenic
999502217 5:152158911-152158933 CAGGTACACCAACCAATCGTAGG + Intergenic
999597043 5:153216065-153216087 CAGGTACTCCAATCAATTGTAGG - Intergenic
999602733 5:153284427-153284449 CAGGTACACCAATAAATCATAGG - Intergenic
999608043 5:153338085-153338107 CAGGTACACCAATCAAATGTAGG + Intergenic
999688463 5:154123673-154123695 CAGATACACCAATCAAATGTAGG - Intronic
999965724 5:156807371-156807393 CAGGTACACCAATCAAATGTAGG - Intergenic
999984084 5:156985966-156985988 CAGGTATACCAATCAAATGTAGG - Intergenic
1000278421 5:159760920-159760942 CAGGTGCAGAAATGAAATGTGGG - Intergenic
1000375979 5:160582707-160582729 CAGGTACACCAATCAAATATAGG + Intronic
1000406637 5:160894567-160894589 CAGGTGCACCAATCAAACATAGG - Intergenic
1000582078 5:163047264-163047286 CAGGTACACCAATCAAACACAGG + Intergenic
1000720036 5:164694443-164694465 CAGGTACCCCAATCCATTGTAGG - Intergenic
1000820044 5:165972283-165972305 CAGGTACAACAATCAAACATAGG + Intergenic
1000860268 5:166449148-166449170 CAGGTACACCAACCAAACATAGG + Intergenic
1000995904 5:167959108-167959130 CAGGTACACCAATCAAATGCAGG + Intronic
1001346237 5:170902149-170902171 CAGGTACACCAATCAAACATAGG + Intronic
1001355750 5:171021399-171021421 CAGGTACACCAATCAAACGTAGG + Intronic
1002216454 5:177638173-177638195 CAGGTACACCAGTCAGATGCAGG + Intergenic
1002673693 5:180891213-180891235 CAGGTACACCAATCAAACGTAGG - Intergenic
1002944999 6:1752399-1752421 CAGGTACACCAATCAAAGGTAGG - Intronic
1003233343 6:4274295-4274317 CAGTTACACTAATGAAATGGAGG - Intergenic
1003628832 6:7768237-7768259 CAGGTCCTCCAAGTGAATGTGGG - Intronic
1003710671 6:8586019-8586041 CAGGTACACCAGTCAAACGCAGG - Intergenic
1003949802 6:11106848-11106870 CAGATACTCAAATTAAATATGGG - Intronic
1004944314 6:20595298-20595320 CAGGTACACCAATCAAACGTAGG + Intronic
1005208383 6:23431389-23431411 CAGGGACAACAATCAAACGTAGG + Intergenic
1005780878 6:29190643-29190665 CAGGTACACCAATCAAACGTAGG + Intergenic
1005785698 6:29243594-29243616 CAGGTATACCAATCAAATGTAGG + Intergenic
1006200156 6:32281040-32281062 CAGGTACACCGATCAATCGTAGG - Intergenic
1007137309 6:39534575-39534597 TAGGTACACCAATCAGACGTAGG - Intronic
1007858296 6:44880441-44880463 CAGGTACACCAATCAAGTGTAGG - Intronic
1008236668 6:49059147-49059169 CAGGTACACCAATCAGACGTAGG - Intergenic
1008254303 6:49277275-49277297 CAGGTACACCAATCAGATGTAGG - Intergenic
1008407444 6:51135062-51135084 CAGGTACACGAATCGTATGTAGG + Intergenic
1008719298 6:54328987-54329009 CAGGTACACCAACCAAAGGTGGG - Intronic
1008758199 6:54823298-54823320 CAGGTACACCAATCAATCATAGG + Intergenic
1008785261 6:55159851-55159873 CAGGTACACTAATCAAATGTAGG - Intronic
1009054463 6:58317946-58317968 CAAGTACACCAATCAAACATAGG - Intergenic
1009182665 6:60536861-60536883 CAGGTACACCAATCAAACATAGG - Intergenic
1009193937 6:60662576-60662598 CAGGTACACCAATCAATCATAGG + Intergenic
1009236675 6:61132628-61132650 CAAGTACACCAATCAAACATAGG + Intergenic
1009264264 6:61533302-61533324 GAGGTACACTAATAAAACGTAGG - Intergenic
1009305746 6:62087820-62087842 CAGGTACACCAATCAAATGTAGG + Intronic
1009536826 6:64897969-64897991 CAGGTACACCAATCAAATGTAGG - Intronic
1009776028 6:68207137-68207159 AAGGTACACTAATCAAATGTAGG - Intergenic
1009776917 6:68217252-68217274 AAGGTACACCAATCAAATGTAGG + Intergenic
1009794913 6:68454946-68454968 CAAGTACACCATTCAAATGTAGG + Intergenic
1009880660 6:69561978-69562000 CAAGTACACCAAATAAATGTAGG - Intergenic
1009945207 6:70335252-70335274 CAGGTACACCAATCAAATGTAGG + Intergenic
1010038989 6:71359943-71359965 CAGGTACATCAATCAAATGTAGG + Intergenic
1010282834 6:74040443-74040465 CAGGTACTCCAATCAGTTGTAGG + Intergenic
1010446849 6:75958517-75958539 CAGGTACACCAATCACATGTAGG + Intronic
1010615495 6:78007050-78007072 CAGGTACATCAATCAAATGTAGG - Intergenic
1010936742 6:81871112-81871134 CAGGTACACCAATCAAACATAGG - Intergenic
1010994164 6:82513780-82513802 CAGGTACACCAGTCAAACGTAGG - Intergenic
1011020542 6:82808118-82808140 CAGGTACACCAATCAAACATAGG + Intergenic
1011071797 6:83393115-83393137 CAGGTCCACCACTGACATGTTGG - Intronic
1011174255 6:84542332-84542354 CAGGTACACCAATCAAATGTGGG - Intergenic
1011235431 6:85211775-85211797 CAGGTACACCTATCAAACGTAGG + Intergenic
1011288744 6:85753150-85753172 CAGGTACACCAATCAAACATAGG - Intergenic
1011298792 6:85852504-85852526 CAGGTACACCAATCAAATGTAGG + Intergenic
1011301305 6:85877524-85877546 CAGGTATAACAATCAAATGTAGG + Intergenic
1011302495 6:85891302-85891324 CATGTACATGAATCAAATGTAGG + Intergenic
1011318551 6:86064421-86064443 CTGGTACAACAATCAAATGTAGG + Intergenic
1011321252 6:86095780-86095802 CAGGTACACCAATCAATTGGAGG - Intergenic
1011332604 6:86226968-86226990 CAGGTACACCGGTGAAATGTAGG + Intergenic
1011333810 6:86238021-86238043 CAGGTACACCAGTGAAATGTAGG - Intergenic
1011340153 6:86305511-86305533 CAGGTACACCAATCAAATGTAGG + Intergenic
1011578365 6:88828901-88828923 CAGGTACACCAATCAAACATAGG - Intronic
1012043556 6:94240185-94240207 CAGGTACACCAATCCAACATAGG - Intergenic
1012082918 6:94784064-94784086 CAGGTACACCAGTCAAACATAGG + Intergenic
1012203304 6:96433212-96433234 CAGGAACACCAATTATTTTTAGG + Intergenic
1012316412 6:97786366-97786388 CAGATACACCATTTTGATGTTGG - Intergenic
1012514212 6:100039834-100039856 CAGGTACACCAATCAAATGTAGG - Intergenic
1012554867 6:100499094-100499116 CAGATACACCAATCAAATGCAGG - Intergenic
1012596967 6:101052783-101052805 CAGGTACACCAATGAAACGTAGG + Intergenic
1012623064 6:101372353-101372375 CAGATACACCAAATAATTGCAGG + Intergenic
1012741022 6:103017149-103017171 CAGGTACTCCAATCAATAGTAGG + Intergenic
1013387536 6:109646602-109646624 CAGGTACACCAATCAAACTTAGG - Intronic
1013453157 6:110304683-110304705 CAGATACACCAATCAATTATAGG - Intronic
1013625497 6:111933599-111933621 CAGGTACACCAGTCAAATATAGG + Intergenic
1013682750 6:112542869-112542891 CAGGTACACCAATCAAACGTAGG - Intergenic
1013939747 6:115646677-115646699 CAGGTATACCAATTAAATATAGG - Intergenic
1013957072 6:115853825-115853847 CAGGTTCACCAATCCAATGTAGG - Intergenic
1014064811 6:117112058-117112080 CAGGTACTCCAATCAGTTGTAGG - Intergenic
1014070535 6:117176391-117176413 CAGGTACACCAATCAAACGTAGG - Intergenic
1014122969 6:117747108-117747130 CAGGTACACCAATCAAACGTAGG - Intergenic
1014225148 6:118839051-118839073 CAGGTACACCAATCAATCGTAGG + Intronic
1014278990 6:119419467-119419489 CAGATACACCAATCAAATGTAGG - Intergenic
1014386920 6:120814814-120814836 CAGGTACACCAATCAAATGTAGG + Intergenic
1014413253 6:121152628-121152650 CAGGTACACCAATCAAATGTAGG + Intronic
1014430946 6:121369742-121369764 CAGGCACACCAATCAAACATAGG - Intergenic
1014466485 6:121762012-121762034 CAGGTACACCAATCAAATGTAGG - Intergenic
1014569191 6:122987712-122987734 CAGGTACACCAATCAAACGTAGG - Intergenic
1014836411 6:126165910-126165932 GAGGTACATCAATCAAATGTAGG + Intergenic
1014864172 6:126507074-126507096 CAGGTACTCCAATCAATCGTAGG - Intergenic
1014868378 6:126559965-126559987 CAGGTACACCAATCAAGTGTAGG - Intergenic
1014872467 6:126613679-126613701 CAGGTACACCAATCAAACATAGG + Intergenic
1015109070 6:129570492-129570514 CAGGTATACCAGTCAAATGTAGG - Intergenic
1015136860 6:129882094-129882116 CAGGTACTCCAGTCAATTGTAGG + Intergenic
1015211473 6:130703128-130703150 CAGGTACACCAATCAAGTGTAGG - Intergenic
1015387119 6:132636635-132636657 CAGGTACACCAATCAAATGTAGG - Intergenic
1015433062 6:133153689-133153711 CAGGTACCCCAATCAATCGTAGG + Intergenic
1015500918 6:133932207-133932229 CAGGTACACCAATCAAACATAGG - Intergenic
1015623232 6:135154963-135154985 CAGGTACACCAATCAAACGTAGG + Intergenic
1015802226 6:137071648-137071670 CAGGTACACCAATCAAACGTAGG - Intergenic
1015883128 6:137890014-137890036 CAGGTACACCAATCAAACGTTGG + Intergenic
1016168080 6:140972938-140972960 CAGGTACACCAATCAGACATAGG + Intergenic
1016242015 6:141941602-141941624 CAGGTACACCAATCAAATGTAGG - Intergenic
1016400052 6:143670470-143670492 CAGGTAGACCATTCAAACGTAGG + Intronic
1016483347 6:144506891-144506913 TGGGTACACCAATCAAATGTAGG + Intronic
1016542323 6:145179461-145179483 CAGGTACACCAATCAGACGTAGG - Intergenic
1016717664 6:147252589-147252611 TAGGTACACCAATCAAACATAGG - Intronic
1017279770 6:152610508-152610530 CAGGTACACCAATCAAACGTAGG - Intronic
1018094379 6:160372623-160372645 CAGGTACACCAATCAAACGTAGG + Intronic
1018114552 6:160570997-160571019 CAGGTACACCAATCAAACGTAGG + Intronic
1018507692 6:164489583-164489605 CAGGTACATCAATTTATTGTAGG + Intergenic
1018797505 6:167198515-167198537 CAGGGACCCCAATTAATTGTAGG + Intergenic
1018805962 6:167259806-167259828 CAGGTACACCAATCAATCATAGG - Intergenic
1019071749 6:169352497-169352519 CTGGTATACCAATCAAACGTAGG + Intergenic
1019091712 6:169540905-169540927 CAGATACACCAATAAAATGAGGG - Intronic
1020338835 7:7087906-7087928 CAGGTACACCAATCAAATGTAGG + Intergenic
1020367085 7:7392602-7392624 CAGGTACACCAATCAAACGTAGG + Intronic
1020487508 7:8737760-8737782 CAGGTACACCAGTCAAAGGTAGG + Intronic
1020519429 7:9167984-9168006 CAGGTACACCAATCAAATGTAGG + Intergenic
1020608465 7:10366359-10366381 CAGGTACACCAATCAATTGTAGG + Intergenic
1020633640 7:10671053-10671075 CAGGTACTCCAATTAATCATAGG + Intergenic
1020690781 7:11352245-11352267 CAGGTACACTAGTAAAACGTAGG + Intergenic
1020716202 7:11676782-11676804 CAAGTACACCAATCAAACTTAGG - Intronic
1020753264 7:12169490-12169512 CAGGTACACCAATCAAACGTAGG + Intergenic
1020874112 7:13672645-13672667 CAGGTACACCAGTCAAACGTAGG + Intergenic
1020884509 7:13804924-13804946 CAGGTACACCAATCAAATGTAGG - Intergenic
1020935563 7:14459616-14459638 CATGTACACCATTCAAACGTAGG - Intronic
1021014819 7:15519181-15519203 CAGGTACAACAATCAAACCTAGG - Intronic
1021208015 7:17808468-17808490 CAGGTACAGCAATCAAACTTAGG - Intronic
1021322466 7:19228377-19228399 CAGGTACACCAATCAAACGTAGG - Intergenic
1021347522 7:19546874-19546896 CAGGTATACCAATCAAATACAGG + Intergenic
1021749198 7:23778464-23778486 CAGGTACACCAGTCAAACGTAGG + Intronic
1021805784 7:24353651-24353673 CAGGTACACCAATGAAACATGGG - Intergenic
1022058685 7:26769084-26769106 CAGGTACACTAATCAAACGTAGG + Intronic
1022173884 7:27854989-27855011 CAGGTACACCAATCAAACATAGG + Intronic
1022630902 7:32083364-32083386 CAGGTACACCAATCAGACGTAGG - Intronic
1022654880 7:32309262-32309284 CAGGTACACCAATCAGACGTAGG - Intergenic
1022848306 7:34234160-34234182 CAGGTACACCAATCAAACGTAGG + Intergenic
1023051590 7:36257450-36257472 CAGGTACACCAATCAAATGTAGG + Intronic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1023511465 7:40958289-40958311 CAGGTACACCAATTAAGCATAGG + Intergenic
1023697608 7:42864054-42864076 CAGGTATACCAATCAAACGTAGG + Intergenic
1024099666 7:46016929-46016951 CAGGTACTCCAATCAATCGTAGG - Intergenic
1024144454 7:46498959-46498981 CAGGTACACCAATCAAACGTAGG - Intergenic
1024495598 7:50042187-50042209 TAGATACACCAATCAAATGTAGG - Intronic
1024664746 7:51535379-51535401 CAGGTACACCAATCAAACGTAGG + Intergenic
1024703202 7:51927125-51927147 CAGGTACACCAATCAAACGTAGG + Intergenic
1024893457 7:54228717-54228739 CAGTAACACCAATTAATTTTAGG - Intergenic
1024900461 7:54313670-54313692 CAGTAACACCAATTAATTTTAGG + Intergenic
1024950364 7:54854644-54854666 CAGGTACACCAATCAAATGTAGG + Intergenic
1025320985 7:58092955-58092977 CAGGTACACCAATCAAACGTAGG - Intergenic
1025479290 7:60961977-60961999 CAGGTACAGCAATCAGACGTAGG - Intergenic
1025552702 7:62270348-62270370 CAGATACACCAATCAGACGTAGG + Intergenic
1025714612 7:63943096-63943118 CAGGCACACCAATCAATTGTAGG - Intergenic
1027583035 7:80021634-80021656 CAGGTACAGCAGTGAAACGTAGG - Intergenic
1027637242 7:80690517-80690539 CAGGTATACCACTCAAATGTAGG - Intergenic
1027699358 7:81450416-81450438 CAGGAACACCAATTATTTTTAGG - Intergenic
1027843502 7:83343141-83343163 CAGGTACACCAATCAAATGAAGG - Intergenic
1028144457 7:87305868-87305890 CAGGTACACCAATCAAACATAGG - Intergenic
1028327169 7:89541478-89541500 CAGGTACACCAATCAAATGTAGG - Intergenic
1028337343 7:89673872-89673894 CAGGTAAACCAATCAAAGGTAGG + Intergenic
1028459330 7:91073033-91073055 CAGGTACTCCAATCAATTGTAGG - Intronic
1028523798 7:91760575-91760597 CAGGCATACCAATCAAATGTAGG - Intronic
1028644308 7:93077874-93077896 CAGGTACTCCAATCAGTTGTAGG - Intergenic
1028786112 7:94795888-94795910 CAGGTACACCAATCAAATGTAGG - Intergenic
1028801246 7:94968768-94968790 CAGGTACACTAATCAAATGTAGG + Intronic
1028945376 7:96573882-96573904 CAAGTACACCAATCAAACGTAGG + Intronic
1029041606 7:97581607-97581629 CAGGTATACCAACCAATTGTAGG - Intergenic
1029808157 7:103017839-103017861 CAGGTACACCAATCAGAACTAGG - Intronic
1029845094 7:103404809-103404831 CAGGTACACCAGTCAAACGTAGG + Intronic
1029850950 7:103461371-103461393 CAGGTACACCAATCAAATGTAGG + Intergenic
1030159696 7:106494403-106494425 CACATACACCAATCAAATGTAGG - Intergenic
1030258094 7:107533679-107533701 CGGGTACAGCAATCAAATGTAGG - Intronic
1030325692 7:108216540-108216562 CAGGTACACCAATCAAACGTAGG + Intronic
1030500661 7:110355405-110355427 CAGGTACACCGATCAAATGTAGG + Intergenic
1030705486 7:112688800-112688822 CAGGTACACCAATCAAATGTAGG + Intergenic
1030736378 7:113053670-113053692 CAGGTACAGCAATCAAACGTAGG + Intergenic
1030801487 7:113857781-113857803 CAGGTACACCAATCAAATGTAGG - Intergenic
1031031954 7:116744553-116744575 CAGGTACACCAATCAAATGTAGG - Intronic
1031397587 7:121292137-121292159 CAGGTACACCAATCAAATGTAGG + Intronic
1031404884 7:121373224-121373246 CTGTTACACAAATTAAATGGAGG - Intronic
1031613617 7:123855826-123855848 CAGGTAAACCAATCAAACATAGG + Intronic
1032295761 7:130637351-130637373 CAGGTACGCCAATCAAACGTAGG + Intronic
1032367881 7:131316971-131316993 CAGATACACCAATCAATCGTAGG - Intronic
1032605139 7:133342646-133342668 CAGGAACACCAATTAATTTTAGG + Intronic
1032659590 7:133968968-133968990 CAGGTACACCAGTCAAACTTAGG + Intronic
1032893461 7:136223973-136223995 CACCAACACCAATCAAATGTAGG - Intergenic
1032911223 7:136432725-136432747 CAGATACACCAATCAAATGTAGG - Intergenic
1032956960 7:136983069-136983091 TAGGTACACCAATCAAACGTAGG + Intronic
1032966591 7:137104845-137104867 CTGGTACACCAATCAAATGTAGG - Intergenic
1033525776 7:142211705-142211727 CAGCTACACCAATCAAATGTAGG - Intronic
1033679436 7:143579526-143579548 CAGGTATACCAATCAAACGTAGG + Intergenic
1033692400 7:143749917-143749939 CAGGTATACCAATCAAACGTAGG - Intergenic
1033977039 7:147115445-147115467 CAGGTACACCAATCAGTTGAAGG + Intronic
1034365643 7:150544152-150544174 CAGGTACACCAATCAAACATAGG - Intergenic
1034714955 7:153233630-153233652 CAGGTCCACTAATCAAATGTAGG + Intergenic
1035491843 7:159286038-159286060 CTGGTACTCCAATCAATTGTAGG - Intergenic
1035696361 8:1600500-1600522 CAGGTACATTAATCTAATGTAGG + Intronic
1035794212 8:2338400-2338422 CAGGTACACCAATCAAACGTAGG - Intergenic
1035798593 8:2383308-2383330 CAGGTACACCAATCAAACGTAGG + Intergenic
1036401714 8:8414587-8414609 CAGGTACACCAATCAAACGTAGG + Intergenic
1036558156 8:9878103-9878125 CAGGTACACCAATCAAATGTAGG - Intergenic
1037258128 8:16978466-16978488 CAGGTACACCAATCAAACATAGG + Intergenic
1037285324 8:17293078-17293100 CAGGTACACCAATCAAACATAGG + Intronic
1037713467 8:21375491-21375513 CAGGAACACCAATTATTTTTAGG + Intergenic
1037719808 8:21432872-21432894 CAGGTACACCAGTCAAACATAGG - Intergenic
1038083150 8:24163161-24163183 CATGTACACCAAGCAAACGTAGG + Intergenic
1039108147 8:34012083-34012105 CAAATACACCAATTAAATGATGG - Intergenic
1039134009 8:34299087-34299109 CAAGTACACCAATCAAACGTAGG - Intergenic
1039283126 8:36007919-36007941 CAGTTACACCAGTCAAATGTAGG - Intergenic
1039754690 8:40511056-40511078 CAGGTACACCAATCAAATGTAGG + Intergenic
1039801945 8:40965521-40965543 CAGGTACACCAGTGAAACGTAGG - Intergenic
1040473187 8:47753474-47753496 CAGGTACACCAATCAAACGTAGG - Intergenic
1040519944 8:48167989-48168011 CAGGTACACCAGTCAAACATAGG + Intergenic
1040736706 8:50516808-50516830 TAGGCACACCAATCAAATGTAGG - Intronic
1040976729 8:53201563-53201585 CAGGTACACCAATCAAATGTAGG - Intergenic
1041583808 8:59493750-59493772 CAGGTACACCAATCAAACGTAGG + Intergenic
1041630415 8:60081575-60081597 CAGGTACACCAATCAAATGTAGG + Intergenic
1041900478 8:62977321-62977343 TAGGTACACCAATCAAACGTTGG + Intronic
1042111088 8:65381464-65381486 CTGGTACACCAATCAAATGTAGG - Intergenic
1042195744 8:66230031-66230053 CAGGTACACCAATCGAATGTAGG - Intergenic
1042327013 8:67539624-67539646 CAGGTATGCCAATCAAATGTAGG + Intronic
1042759813 8:72258355-72258377 CAGGTACCCCAATCATTTGTAGG - Intergenic
1042812753 8:72844566-72844588 CAGGTATACCAATCAAATGTAGG + Intronic
1042946337 8:74158022-74158044 CACGTACACCAGTCAAATGTAGG - Intergenic
1042969162 8:74389803-74389825 CAGGTACACCAATCAATTGTAGG + Intronic
1043233483 8:77831416-77831438 CAGGTATTCCAATCAATTGTAGG - Intergenic
1043244291 8:77978364-77978386 CAGGTATACCAATCAAATGTAGG + Intergenic
1043253497 8:78105219-78105241 CAGATACACCAATCAACCGTAGG + Intergenic
1043366189 8:79536098-79536120 CAGGTACACCAGTCAAATGTAGG + Intergenic
1043368122 8:79559287-79559309 CAGGTCCACCAATCAAATGTAGG + Intergenic
1043532588 8:81167177-81167199 CAGGTACACCAATCAAATGTAGG - Intergenic
1043647094 8:82534979-82535001 CAGGTACACCAATCAAACGTAGG + Intergenic
1043703739 8:83323120-83323142 CATGTACACCAATCAAACATAGG - Intergenic
1044038494 8:87336324-87336346 CAGGTACTCCAGTTAGTTGTAGG + Intronic
1044131255 8:88526700-88526722 CAGGTACACCAGTCAAACGTAGG - Intergenic
1044267885 8:90204668-90204690 CAGGTACACCAATCAAACGTAGG - Intergenic
1044315687 8:90748127-90748149 CAGGTACTCCAATTAGTTGTAGG + Intronic
1044377977 8:91498979-91499001 CAGGTACACCAATAAATCATAGG + Intergenic
1044509311 8:93057126-93057148 CAGGTACACCAGTCAAACGTAGG + Intergenic
1044610510 8:94087517-94087539 CAGGTACACCAATCAATCATAGG + Intergenic
1044614510 8:94126078-94126100 CAGGTACACCAATCAATCATAGG + Intergenic
1044873242 8:96640796-96640818 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1044940096 8:97333770-97333792 CAGGTACACCAATCAAATGTAGG + Intergenic
1044961161 8:97531692-97531714 CAGATACAGCAATCAAATGTAGG - Intergenic
1045185013 8:99829225-99829247 TAGGTACACCAATCAAATGTAGG + Intronic
1045199815 8:99968743-99968765 CAGGTACACCAAACAATTGTAGG - Intronic
1045327128 8:101125940-101125962 CAGGGGCACTTATTAAATGTAGG + Intergenic
1045973536 8:108105658-108105680 CAGGTACACCAGTTAAACATAGG - Intergenic
1046014773 8:108591581-108591603 CAGGTTTACCAATCAATTGTAGG - Intergenic
1046047819 8:108985190-108985212 CAGGTACACCAATAAAACATAGG + Intergenic
1046067829 8:109217643-109217665 CAGGTACACCAATCAAACGTAGG + Intergenic
1046106653 8:109674044-109674066 CAGGTACACCAATCAAAAGTAGG - Intronic
1046277956 8:111987092-111987114 CAGGTACACCAATCAAATGTAGG - Intergenic
1046480483 8:114810737-114810759 CAAGTACATCAATTAAAAATGGG - Intergenic
1046947323 8:119986655-119986677 CAGGTACACCAATCAAACATAGG + Intronic
1047121462 8:121909444-121909466 CAGGTACACCAATCAATCATAGG - Intergenic
1047133830 8:122052871-122052893 CAGGTATACCAATCAAATGTAGG - Intergenic
1047143511 8:122170014-122170036 AAAGTACCCCAATTAACTGTAGG + Intergenic
1047473310 8:125200801-125200823 CAGCTACACCAATCAAACGTAGG + Intronic
1049872216 8:144989417-144989439 CAGATACACCAATCAATCGTAGG + Intergenic
1049964762 9:768235-768257 CGGGTACACCAATCAGTTGTAGG - Intergenic
1050031923 9:1394891-1394913 CAGGTACACCAATCAATCATAGG - Intergenic
1050129998 9:2402297-2402319 CAGGTACACCAATCAATTGTAGG + Intergenic
1050141402 9:2520138-2520160 TAGGTCCATCAATCAAATGTAGG + Intergenic
1050201056 9:3146519-3146541 CAGGTAGACCAATCAAATGTAGG + Intergenic
1050234225 9:3561518-3561540 CAGGTACACCAATCAAACGCAGG + Intergenic
1050239751 9:3622959-3622981 CAGTTAAACCAATCAAATGTAGG + Intergenic
1050240055 9:3625440-3625462 CAGGTACCCCAGTCAATTGTAGG + Intergenic
1050300336 9:4252233-4252255 CAGGTACACCAATCAAATGTAGG + Intronic
1050492537 9:6204041-6204063 CAGGTACACCAATCTAACGCAGG - Intergenic
1050660899 9:7881380-7881402 CAGGTACTCCAATCAATCGTAGG - Intronic
1050943011 9:11484374-11484396 CAGGTACACCAATCAAACATGGG + Intergenic
1050963469 9:11767075-11767097 CAGGTACACCAATCAATCATAGG - Intergenic
1050973755 9:11911034-11911056 CAGGTACACCAATCAAACATAGG + Intergenic
1051036011 9:12746346-12746368 CTGGTACACCAATCATTTGTAGG + Intergenic
1051045594 9:12869424-12869446 CAGGTAAACCAATGGAACGTAGG + Intergenic
1051230625 9:14951242-14951264 CAGGTACACCAGTCAAACGTAGG - Intergenic
1051303196 9:15676000-15676022 CAGGTACACCAATCAAATGCAGG + Intronic
1051571334 9:18562643-18562665 CAGGTACACCAGTCAAACATAGG + Intronic
1051611482 9:18966367-18966389 CAGGTATACCAATCAAAAGTGGG + Intronic
1051695661 9:19765923-19765945 CCGGTATACCAATCAAATGTAGG + Intronic
1051843737 9:21428249-21428271 CAGGTACTCCAATCAGTTGTAGG + Intronic
1051940069 9:22495076-22495098 TTGGTACACCAATGAAACGTAGG + Intergenic
1051983067 9:23047210-23047232 CAGGTATTCCAATCAATTGTAGG - Intergenic
1051998623 9:23249254-23249276 CAGGTACGCCAATCAAACGTAGG - Intergenic
1052052558 9:23865234-23865256 CAGGTACACCAATCAAACGCAGG + Intergenic
1052061398 9:23965314-23965336 CAAGAACACCAATCAAATATAGG + Intergenic
1052241535 9:26278932-26278954 CAGGTATACCAATCAAACGTAGG - Intergenic
1052281067 9:26734194-26734216 CAGGTACACCAATCAAATGTAGG + Intergenic
1052336235 9:27323256-27323278 CAGGTACACCAATCAAACGTAGG + Intergenic
1052382180 9:27783832-27783854 CAGGTACACCAATCAAATGTAGG + Intergenic
1052410543 9:28116542-28116564 CAGGTACACCAATCAGACGTAGG + Intronic
1052506452 9:29359907-29359929 CAGGTACACCAATCAATCATAGG - Intergenic
1052632594 9:31060697-31060719 CAGGTACACCAATCAGATGCAGG + Intergenic
1052667847 9:31518012-31518034 CAGATACACCAGTCAAACGTAGG + Intergenic
1052717098 9:32130001-32130023 CAGGTACTCCAATCAATTGTAGG - Intergenic
1052752897 9:32510102-32510124 CGGGTACACCAATCAAACATAGG - Intronic
1053524355 9:38813554-38813576 CAGGTACTCAAAGAAAATGTAGG - Intergenic
1053678867 9:40465992-40466014 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1053753411 9:41278938-41278960 CAGGTACACCAATTAGTCTTAGG + Intergenic
1053928850 9:43094345-43094367 CCGGTACACCAATCAGTTGTAGG - Intergenic
1054196588 9:62037963-62037985 CAGGTACTCAAAGAAAATGTAGG - Intergenic
1054258937 9:62843301-62843323 CAGGTACACCAATTAGTCTTAGG + Intergenic
1054284858 9:63158950-63158972 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1054291945 9:63301530-63301552 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1054332845 9:63776739-63776761 CAGGTACACCAATTAGTCTTAGG - Intergenic
1054389963 9:64606073-64606095 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1054505751 9:65910303-65910325 CAGGTACCCCAATCAGTTGTAGG + Intergenic
1054641817 9:67550722-67550744 CAGGTACTCAAAGAAAATGTAGG + Intergenic
1055085132 9:72306025-72306047 GAGGGACACAAATTAAATATAGG - Intergenic
1055175189 9:73310399-73310421 CAGGTACAGCAATCAAATGTAGG - Intergenic
1055210457 9:73784516-73784538 CAGGTACACCAATCAAACGTAGG - Intergenic
1055239389 9:74165141-74165163 CAGATACACCAATCAAATGTAGG - Intergenic
1055537719 9:77266789-77266811 CAGGTACACCAGTCAAATGTAGG + Intronic
1055571931 9:77625261-77625283 TAGGTACACCAATCAAATGTAGG - Intronic
1056001126 9:82217425-82217447 CAGAAACACCAATCAAATGTAGG - Intergenic
1056003368 9:82241628-82241650 CAGGTACAGCAATCAAACATAGG + Intergenic
1056015143 9:82377459-82377481 CAGGTACTCCAATCAGTTGTAGG - Intergenic
1056123879 9:83515483-83515505 CAGTTACATCAATCAAATGTAGG - Intronic
1056176628 9:84042703-84042725 CAGGTACACCATTCAAACGTAGG + Intergenic
1056302479 9:85256775-85256797 CAGGTACACCAATCAAACAACGG + Intergenic
1056321069 9:85434929-85434951 TCAGTACACCAATCAAATGTTGG - Intergenic
1056384988 9:86089383-86089405 CAGGTACACCAATCAAACATAGG + Intronic
1057551406 9:96053474-96053496 CATGTCCACCAAATCAATGTGGG + Intergenic
1058182675 9:101817024-101817046 CAGGTACACCAATCAAACGTAGG - Intergenic
1058211297 9:102173318-102173340 CAAGTACACCAATCAGACGTAGG + Intergenic
1058275896 9:103040356-103040378 CAGGAACACCAATTATTTTTAGG - Intergenic
1058408614 9:104704970-104704992 CAGGTACACCAATCAAACACAGG - Intergenic
1059089007 9:111335809-111335831 CAGGTATACCAATGAAACATAGG - Intergenic
1059185345 9:112264120-112264142 CAGGAAAACAAATTTAATGTGGG + Intronic
1059675578 9:116535984-116536006 CAGGTACACCAATCAGATGTAGG + Intronic
1059746066 9:117202962-117202984 CTGGTACTCCAATCAATTGTAGG + Intronic
1059954749 9:119503693-119503715 CAGGTGTACCAATCAAATATAGG - Intronic
1202799844 9_KI270719v1_random:165050-165072 CAGGTACACCAATTAGTCTTAGG - Intergenic
1186773161 X:12837981-12838003 CAGATACACCAATGAAACATAGG + Intergenic
1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG + Intergenic
1188201849 X:27301034-27301056 CAGATACACCAATCAAAGGTAGG - Intergenic
1188216622 X:27486683-27486705 CAAATAACCCAATTAAATGTGGG - Intergenic
1188296522 X:28456702-28456724 CAGGTACACAAATCAAACGTAGG - Intergenic
1188455116 X:30355319-30355341 CAGGTACACTAATCAGTTGTAGG + Intergenic
1188561088 X:31469797-31469819 CAGGTACACCAATCAAATGTAGG + Intronic
1188893132 X:35635004-35635026 CAGGTACACCAATCAAACGTAGG + Intergenic
1188915296 X:35903478-35903500 CAGGTACACCAATCAATTGTAGG + Intergenic
1188921768 X:35986233-35986255 CAGGTACACCAATCAAATGTAGG + Intronic
1189189790 X:39090324-39090346 AAGGTACACCAATCAAATGTAGG - Intergenic
1189210658 X:39279327-39279349 CAGGTACACCAGTCAAACATAGG + Intergenic
1189243498 X:39543604-39543626 CAGGTACACCAATCAAACATAGG - Intergenic
1189557953 X:42164854-42164876 CAGGAACACCAATGAGTTGTAGG + Intergenic
1189574947 X:42341993-42342015 CAGGTACACCAATCAAATGTAGG + Intergenic
1189590790 X:42508529-42508551 CAGGTATTCCAGTCAAATGTAGG - Intergenic
1189721707 X:43926422-43926444 CAGGTACACCAATCAAACGTAGG + Intergenic
1189937923 X:46088638-46088660 CAGGTACACCAATCAAACGTAGG - Intergenic
1190341300 X:49298640-49298662 CAGGTACACCAGTCAAATGTAGG + Intronic
1190420234 X:50222893-50222915 CAGGTACACGAATCAAACGTAGG + Intronic
1190506041 X:51126735-51126757 CAGGTACACCAATCAAATGTAGG - Intergenic
1190529831 X:51363126-51363148 CTGGTACTCCAATCAATTGTAGG - Intergenic
1190924395 X:54888996-54889018 CAGGTACTCCAATCAATTGTAGG - Intergenic
1190992650 X:55567717-55567739 CAGGTACCCCAATCAGTTGTAGG - Intergenic
1190995541 X:55605144-55605166 CAGGTACACCAATCTATTGTAGG + Intergenic
1191024418 X:55897885-55897907 CAGGTACACCAATCAAATGTAGG - Intergenic
1191071883 X:56409646-56409668 CACTTACATCAATCAAATGTAGG + Intergenic
1191072805 X:56420263-56420285 CAGGTACACCAATCAGATGTAGG + Intergenic
1191119873 X:56892137-56892159 CAGGCACACCAATTAATCGTAGG - Intergenic
1191135187 X:57056976-57056998 CAGGTACACCAGTCAAATGTAGG + Intergenic
1191153396 X:57244259-57244281 CAGGTACACCAATCAAACATAGG - Intergenic
1191168393 X:57416854-57416876 CTGGTACACCAATCAAACGTAGG + Intronic
1191206852 X:57843591-57843613 CAGGTACACCAATCAAATGTAGG - Intergenic
1191208251 X:57856502-57856524 CAGGTACACCAATCAAACGTAGG - Intergenic
1191606402 X:63067165-63067187 CAGGTACACCAAACAAAGGTAGG - Intergenic
1191632100 X:63332554-63332576 CATGTACACCTATCGAATGTAGG - Intergenic
1191657599 X:63614974-63614996 CAGGTATGCCAATCAAACGTAGG - Intergenic
1191705263 X:64087130-64087152 TAGGTACACCAATCAAATGTAGG - Intergenic
1191725634 X:64277855-64277877 CAGGTACACCAATCAAATGTAGG + Intronic
1191771444 X:64763648-64763670 CAGATACACCAATCAAACATAGG + Intergenic
1191787897 X:64936286-64936308 CAGGTACACCAATGAAACGTAGG - Intronic
1191809379 X:65170662-65170684 CAGGTACACCAATGAGACGTAGG + Intergenic
1191825002 X:65354975-65354997 CAGGTACAAAAATCAAATGTAGG - Intergenic
1191848441 X:65567949-65567971 CAGGTACACCAATCAAATGTAGG + Intergenic
1191872788 X:65764025-65764047 CATGTACACCCATCAAACGTAGG + Intergenic
1191925859 X:66309178-66309200 CAAGTACACCAATTAAACATAGG - Intergenic
1191931212 X:66375268-66375290 CAGGTACACCAATAAAATGCAGG + Intergenic
1191984981 X:66969972-66969994 CAGGTACATCAGTCAAATGTAGG - Intergenic
1192009408 X:67251710-67251732 CAGGTACAGCAATCAAACATAGG - Intergenic
1192018605 X:67359263-67359285 CAGGTACACCAATCAAATGTAGG - Intergenic
1192128830 X:68529105-68529127 CTGGTACACCAATCAAAGGTAGG + Intronic
1192228611 X:69247426-69247448 CAGGTACACCAATCAAATGTAGG - Intergenic
1192451314 X:71246777-71246799 CAGGTACACCAAATACAGATGGG + Intronic
1192637013 X:72829750-72829772 CAGGTACACCAATCAAACGTAGG + Intronic
1192644701 X:72891064-72891086 CAGGTACACCAATCAAACGTAGG - Intronic
1192662282 X:73053887-73053909 CAGGTACACCAATCAAATGTAGG - Intergenic
1192667725 X:73105432-73105454 CAGAAACACTAATTACATGTAGG - Intergenic
1192674721 X:73183894-73183916 CAGGTACACCAATCAAATGTAGG - Intergenic
1192701627 X:73480943-73480965 CAGGTACACCAATCAATCATAGG + Intergenic
1192707566 X:73542402-73542424 CAGGTATATCAATCAAACGTAGG - Intergenic
1192727943 X:73772012-73772034 CAGGTACACCAATCAAACATAGG - Intergenic
1192741172 X:73894030-73894052 CAGGTACACCAATCAAACGTAGG - Intergenic
1192858139 X:75036247-75036269 CAGGTACACCAATCAAACGTAGG + Intergenic
1192883485 X:75312793-75312815 CAGGTACACCAATCAATCATAGG + Intergenic
1192897737 X:75461298-75461320 CAGGTACCCCAATCAGTTGTAGG - Intronic
1192915900 X:75651082-75651104 CAGGTACTCCAATCAATCGTAGG + Intergenic
1192922591 X:75723220-75723242 CAGGTATACCAATCAAACGTTGG + Intergenic
1192931957 X:75815695-75815717 CAGGTACACTAATCAAACGTAGG - Intergenic
1192937875 X:75880270-75880292 CAGGTACACCAGTCAAATGTAGG + Intergenic
1192952077 X:76027620-76027642 CAGGTACTCCAATCAATCGTAGG - Intergenic
1192966385 X:76181907-76181929 CAGGTACACCAATCAATCATAGG + Intergenic
1192979782 X:76327419-76327441 CAGGTACACCAATCAGACGTAGG + Intergenic
1192992263 X:76472704-76472726 CAGATACTCCAATTAAATGTAGG - Intergenic
1192994148 X:76494154-76494176 CAGGTACACCAATGAATCGTAGG - Intergenic
1192999322 X:76547242-76547264 CAGGTACACCAATCAAACGTAGG + Intergenic
1193055474 X:77144928-77144950 CAGGTACACCAATCAATCATAGG - Intergenic
1193064603 X:77245645-77245667 CAGGTACACCAGTCAGACGTAGG - Intergenic
1193075328 X:77349000-77349022 CAAGTACACCAATCAAACTTAGG - Intergenic
1193081430 X:77410659-77410681 CAAGTACACCAATCAAACTTAGG + Intergenic
1193174209 X:78372958-78372980 CAGGTACACCAATCAAACATAGG + Intergenic
1193243163 X:79196786-79196808 CATGTACACCAGTCAAATGTAGG - Intergenic
1193245132 X:79219176-79219198 CAGGTATACCAATGAAACTTAGG + Intergenic
1193284475 X:79695908-79695930 CAGGTACACCAATCAAATGTAGG + Intergenic
1193290762 X:79770229-79770251 CAGGTACACCAATCAGACGTAGG + Intergenic
1193334800 X:80275245-80275267 TAGGTACGCCAATCAAACGTAGG - Intergenic
1193350981 X:80464000-80464022 CAGGTACACCAATCAAATGTAGG - Intergenic
1193351893 X:80473783-80473805 CAGGTACACCAGTCAAACATAGG + Intergenic
1193389365 X:80907952-80907974 CAGGGACCCCAATCAATTGTAGG - Intergenic
1193394376 X:80967122-80967144 CAGGTACACCAATCAAACGTAGG + Intergenic
1193514546 X:82447106-82447128 CAGGTACACCAATAAATCGTAGG - Intergenic
1193594943 X:83434627-83434649 CAAGTACACCAATCAAACTTAGG + Intergenic
1193615860 X:83687546-83687568 CAGGTACACCAACCAAATGTAGG + Intergenic
1193784280 X:85740373-85740395 CAGGTACACCAATCAATCATAGG - Intergenic
1193830154 X:86279966-86279988 CAGGTACACCAGTAAAACGTAGG - Intronic
1193878883 X:86897372-86897394 CAGGTACACCAGTCAAATGTAGG - Intergenic
1193897413 X:87130103-87130125 CAGGCACACCAATCAAACATAGG - Intergenic
1193991202 X:88309876-88309898 CAGGTACACCAATCAATCGTAGG - Intergenic
1194021413 X:88696044-88696066 CAGGTGCACCAATCAAACATAGG - Intergenic
1194029975 X:88801151-88801173 CAGGTACACCAATCAAATGTAGG - Intergenic
1194098726 X:89675632-89675654 CAGGTACACCAATCAAACATAGG - Intergenic
1194118839 X:89936444-89936466 CAGGTACACCAATCAAACGTAGG + Intergenic
1194140013 X:90197475-90197497 CTGGTACACCAATCAAATGTAGG - Intergenic
1194203692 X:90985019-90985041 CAGGTACACCAATCAAACATAGG - Intergenic
1194208369 X:91038787-91038809 CAGGTACACCAATCAAACGTAGG + Intergenic
1194229027 X:91299177-91299199 CAGGTACACCAATCAAATGTAGG + Intergenic
1194230807 X:91321101-91321123 TAGTTACCCCAATCAAATGTAGG + Intergenic
1194242717 X:91471307-91471329 CAGGTACACCAATCAAACGTAGG - Intergenic
1194286942 X:92021534-92021556 CAGGTACTCCAATCAATCGTAGG - Intronic
1194420080 X:93662202-93662224 CAGGTACATCAATCAAACGTAGG - Intergenic
1194515187 X:94843815-94843837 CAGGTACACCAATCAAATGTAGG + Intergenic
1194559665 X:95404441-95404463 CAGGTACACTAATTAAATGTAGG - Intergenic
1194576191 X:95617545-95617567 CAGGTGCACCAATCAAATGTAGG + Intergenic
1194624933 X:96216043-96216065 CAGGTACACCAACCAAACATAGG - Intergenic
1194643231 X:96428199-96428221 CAGGTACACCAATCAAACGTAGG + Intergenic
1194771956 X:97916760-97916782 CAGGTATACCAATGAAATGTAGG - Intergenic
1194782981 X:98047979-98048001 CAGGTACGCCAATCAAATGCAGG + Intergenic
1194798235 X:98239460-98239482 CAGGTATACCAATTAAACATAGG + Intergenic
1194826088 X:98564719-98564741 CAGGTACACCAATCAGACTTAGG + Intergenic
1194958905 X:100213402-100213424 CAGGTACACCAACCAAATGCAGG + Intergenic
1194964156 X:100268327-100268349 CAGGTACAGCAATCAAACGTAGG - Intergenic
1195434540 X:104827753-104827775 CAAGTATACCAATCAAACGTAGG + Intronic
1195469193 X:105213491-105213513 CAGGTACACCAATCAATCATAGG - Intronic
1195519090 X:105811065-105811087 CAGGTACACCAGTCAAACGTAGG + Intergenic
1195812814 X:108852703-108852725 CAGGTACCCCAATCATTTGTAGG - Intergenic
1195985734 X:110627831-110627853 CAGGTACACCAAAAAAATGTAGG - Intergenic
1196133553 X:112182681-112182703 CAGGTATACCAATCAAATGTAGG - Intergenic
1196273014 X:113734627-113734649 CAGGTACACCAATCAAATGTAGG + Intergenic
1196435760 X:115673100-115673122 CAGGTACACCAGTCAAACGTAGG - Intergenic
1196464966 X:115961923-115961945 CAGGTACACCAATTATTCTTAGG - Intergenic
1196467217 X:115984504-115984526 CCAGTACACCCATCAAATGTAGG - Intergenic
1196482032 X:116160703-116160725 CAGGTACACCAATCAGATGTAGG - Intergenic
1196571444 X:117269882-117269904 CAAGTACTCCAATCAAACGTAGG - Intergenic
1196602795 X:117621709-117621731 CAGGTACACCAATCAAATGTAGG + Intergenic
1196631326 X:117943454-117943476 CAGGTACACCAATCTAACTTAGG + Intronic
1196946438 X:120831682-120831704 CAGGTACACCAATTAAATTTAGG + Intergenic
1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG + Intergenic
1197157386 X:123284764-123284786 GAGGTACACCAATCAAATGCCGG - Intronic
1197191245 X:123649819-123649841 CAGGTACACCAATCAAACGTAGG - Intronic
1197319260 X:125007397-125007419 CAGATACTCCAATCAATTGTAGG - Intergenic
1197349977 X:125371385-125371407 CAGGTACACCAATCAAACGTAGG + Intergenic
1197506159 X:127307312-127307334 CAGGTACACCAATCAATCGTTGG - Intergenic
1197543093 X:127790278-127790300 CGGGTACAGCAATCAGATGTAGG - Intergenic
1197575754 X:128209047-128209069 CAGGAACACCAATTATTTTTAGG - Intergenic
1197847199 X:130815262-130815284 CAGGTACACCAATCAAACATAGG - Intronic
1197880609 X:131163036-131163058 CAGGTACACCAATCAAATGTAGG + Intergenic
1197906408 X:131429782-131429804 CAGGTACGCAAATCAAACGTAGG - Intergenic
1197927069 X:131657690-131657712 CGGGTACACCAATCAAATGTAGG - Intergenic
1198042215 X:132864621-132864643 CAAGTACACCGATCAAGTGTAGG - Intronic
1198062758 X:133063242-133063264 CAGGTACCCCAATCAATCGTAGG - Intronic
1198072312 X:133160852-133160874 CATGTACACCAATCAAACTTAGG - Intergenic
1198085790 X:133280452-133280474 CAAGTACACCAATCAAACATAGG - Intergenic
1198295243 X:135281116-135281138 CAGGTACACCAGTGAAATGTAGG + Intronic
1198490095 X:137130951-137130973 CAGGTACACCAATCAAACGTAGG - Intergenic
1198519160 X:137434883-137434905 CAGGTACACCAATCAAATGTAGG - Intergenic
1198678797 X:139158840-139158862 CAGGTACACCAGTCAAATGTAGG - Intronic
1198753703 X:139960442-139960464 CAGGTGCACCAATCAATCGTAGG - Intronic
1198784320 X:140271511-140271533 CAGGTACACCAGCCAATTGTAGG + Intergenic
1198888568 X:141366843-141366865 CAGGTACTCCAATCAATTGCAGG - Intergenic
1199011987 X:142769089-142769111 TAGGTACACCAATCAAACGTGGG + Intergenic
1199079660 X:143562405-143562427 CAGGTACCCCAATTAGTAGTAGG - Intergenic
1199094629 X:143724985-143725007 TAGGTACACCAATCAAATGTAGG - Intergenic
1199098761 X:143773151-143773173 CTGTTACAGCATTTAAATGTCGG - Intergenic
1199200467 X:145081806-145081828 TATGTACACCAAGAAAATGTGGG - Intergenic
1199801378 X:151254243-151254265 CAGGTACACCAATCAATCGTAGG - Intergenic
1199830854 X:151547625-151547647 CAGGTACACCAATCAATCATAGG - Intergenic
1199872275 X:151910498-151910520 CAGGAACACGAAGTAGATGTAGG + Intergenic
1200321461 X:155194622-155194644 CAGGTACCCCAATTATTCGTTGG + Intergenic
1200323129 X:155210759-155210781 CAGCTACAGCAATTACATGCTGG - Intronic
1200333384 X:155321077-155321099 CAGGTACACCAGTCAAACGTAGG - Intronic
1200416905 Y:2921526-2921548 TAGGTACATCAATCAAATGTAGG + Intronic
1200451750 Y:3337005-3337027 CAGGTACACCAATCAAACATAGG - Intergenic
1200471716 Y:3594006-3594028 CAGGTACACCAATCAAACGTAGG + Intergenic
1200485758 Y:3766442-3766464 CTGGTACACCAATCAAATGTAGG - Intergenic
1200549526 Y:4560466-4560488 CAGGTACACCAATCAAACATAGG - Intergenic
1200604485 Y:5246094-5246116 CAGGTACTCCAATCAATCGTAGG - Intronic
1200623183 Y:5479658-5479680 CAGGTAAACCAATTAATCATAGG + Intronic
1200732433 Y:6757293-6757315 CAGGTATAGCAATCAAATGTAGG + Intergenic
1201511701 Y:14771069-14771091 CAGGTACACCAAGCAAATGTAGG - Intronic
1201541440 Y:15109410-15109432 CAGGTACACCAATCAAAGGTAGG + Intergenic
1201543327 Y:15133005-15133027 CAGGTACACCAATCAAATGTAGG - Intergenic
1201563366 Y:15341831-15341853 CAGGTACCCCAATCAAATGTAGG + Intergenic
1201591364 Y:15618267-15618289 CAGGTACACCAATCAATTGTAGG - Intergenic
1201672599 Y:16540991-16541013 CAGGTACATCAATCAAACATAGG - Intergenic
1201689853 Y:16751656-16751678 CAAGTACACCAATCAAATGTAGG + Intergenic
1201707302 Y:16951103-16951125 CAGGTAGACCCATCAAATGTAGG - Intergenic
1201782291 Y:17736892-17736914 CAGGTACACCAATCAATTATAGG + Intergenic
1201819262 Y:18169096-18169118 CAGGTACACCAATCAATTATAGG - Intergenic
1201854172 Y:18522496-18522518 TAGGTACACCAATCAATTGTAGG - Intergenic
1201879149 Y:18797888-18797910 TAGGTACACCAATCAATTGTAGG + Intronic