ID: 921485267

View in Genome Browser
Species Human (GRCh38)
Location 1:215708076-215708098
Sequence AGTGGGAAGAAGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 791}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921485260_921485267 9 Left 921485260 1:215708044-215708066 CCATCATATCTGAAGCAAAAATC 0: 1
1: 1
2: 1
3: 28
4: 282
Right 921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG 0: 1
1: 0
2: 6
3: 71
4: 791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921485267 Original CRISPR AGTGGGAAGAAGGATGTGGA AGG Intronic
900601271 1:3503760-3503782 AGCGGGAGGAAGGGTGGGGAGGG + Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900719820 1:4168290-4168312 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
900724937 1:4209967-4209989 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
900926081 1:5706976-5706998 AGTGGGATGAAGAATGTGAGAGG - Intergenic
901007212 1:6177978-6178000 AGTGGGTAGAAGGCCCTGGAGGG + Intronic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
901723496 1:11219731-11219753 AGTGGGAATAAGGCTGGGCACGG + Intronic
901768374 1:11518119-11518141 GTTGGGAAGATGGAGGTGGATGG + Intronic
901849635 1:12007310-12007332 CGTGGGAAGAGAGATGGGGAAGG - Intronic
902136443 1:14310143-14310165 AGTGGGAAGAAGGATATTACAGG + Intergenic
902190581 1:14760175-14760197 GGTGGGAAGAGGGTTGGGGAAGG - Intronic
902218090 1:14947284-14947306 AGAGGGAGGATGGATGAGGATGG + Intronic
902382737 1:16060226-16060248 AGTGAGCAGAAGGCTTTGGAGGG - Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902723797 1:18322347-18322369 AGAGGGAAGACGGGCGTGGAAGG - Intronic
903029084 1:20449802-20449824 GATGGTAACAAGGATGTGGAGGG + Intergenic
903186407 1:21631845-21631867 AGTGGGATGCACGCTGTGGAAGG - Intronic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
903214368 1:21835334-21835356 GGAGGGAAGAAGGATATGGATGG - Intronic
903317322 1:22518541-22518563 TGTGGGAAGAGGGGTGGGGAGGG - Intronic
903541891 1:24101137-24101159 AGAGGGAACAATGATGTGAAAGG - Intronic
903560371 1:24222429-24222451 AGTGGGAAGAGGGAGGAGCAGGG + Intergenic
903879167 1:26497108-26497130 AGGATGAGGAAGGATGTGGAAGG - Intergenic
903977085 1:27157451-27157473 AGAGGGAGGAAGGAGGTGGTAGG + Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904865460 1:33575343-33575365 TGTGGGAAGTAGGAGGTGGGTGG + Intronic
904995094 1:34625591-34625613 AGTTGGAGGAAGGAGGTGGCTGG - Intergenic
905028227 1:34865601-34865623 AGTGGGCAGAGGGCTGAGGATGG + Exonic
905031554 1:34887259-34887281 AGTGGATAGAAGGTTGGGGAAGG - Intronic
905365608 1:37449666-37449688 AGTGGGAAGCTGGGAGTGGAAGG + Intergenic
905409400 1:37757914-37757936 AGAGGGGAGATGGTTGTGGATGG - Intronic
905536125 1:38723248-38723270 AGCGGGCAGAGGAATGTGGAAGG - Intergenic
905582106 1:39090110-39090132 AGTGGGAAGAAGGGAATGCAGGG + Intronic
906065259 1:42975929-42975951 GGGTGGAAGAAGGGTGTGGAAGG + Intergenic
906067844 1:42994959-42994981 GGTTGGAAGAAAGATGTGGAAGG + Intergenic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906196147 1:43931921-43931943 AGTGGGAAGGAGCATGTGGGAGG - Intergenic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
906879253 1:49572909-49572931 AGTGGGCAGAAAAATGTGAAAGG + Intronic
906950439 1:50330959-50330981 AGTGGGAAGACGGCTGGGGCAGG - Intergenic
907457122 1:54582976-54582998 AGTGGGTAGAGGGAGGTGGTAGG - Intronic
907788654 1:57639538-57639560 AGTGTGAAGGAGGGTTTGGAAGG + Intronic
908014847 1:59820440-59820462 AGTGCAAAGAAGGCTGGGGAAGG - Intronic
908702715 1:66919921-66919943 AGTGGGAAGATGTAGGGGGAGGG - Intronic
911452594 1:98083884-98083906 AGGGGGAAGACGGAAGAGGAAGG - Intergenic
912262717 1:108124890-108124912 AGTAGGAATCAGGACGTGGAAGG - Intergenic
912500261 1:110116980-110117002 CATGGGTAGAAGGAAGTGGAGGG + Intergenic
912661320 1:111533438-111533460 GGTGGGATGAAGGATGGGAAAGG - Intronic
912662057 1:111540591-111540613 AGTGGGAAGATGCATGTAAATGG - Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913114134 1:115681288-115681310 AGTGGGAGAGAGGATGTGGGAGG - Intronic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
913678097 1:121161354-121161376 AATGGGAAGAAGGTTTTGAAGGG + Intergenic
914029933 1:143948983-143949005 AATGGGAAGAAGGTTTTGAAGGG + Intronic
914159516 1:145118967-145118989 AATGGGAAGAAGGTTTTGAAGGG - Intergenic
914902212 1:151716808-151716830 AGTGGGGAGGGGGGTGTGGAGGG - Exonic
915022051 1:152788192-152788214 AGTGGGAAGGAGGATGAAGTCGG - Exonic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915541391 1:156569195-156569217 AGTGGGTAAAAGGATGTGACTGG + Intronic
915603689 1:156937972-156937994 AGCTGGAGGAAGGACGTGGAGGG + Intronic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
916168891 1:161986067-161986089 GGTGGGAAGAGGGCAGTGGAAGG + Intronic
916490764 1:165300403-165300425 AATGGGAAGAAGGATGGGTTAGG - Intronic
916499121 1:165371342-165371364 AGTGTGGAGATGGAGGTGGAGGG - Intergenic
916514097 1:165499117-165499139 AGCAGGAAGAAGCATTTGGAAGG + Intergenic
916652079 1:166842094-166842116 ATTGGGAAGAAGGATGTGGTGGG - Intronic
917554348 1:176068209-176068231 AGAAGGAAGAAGGAAGGGGAAGG - Intronic
917641161 1:176984351-176984373 TCTGGGAAAAAGGAAGTGGAAGG + Intronic
918039506 1:180904614-180904636 ATTGGGTAGAAGGACATGGAGGG - Intergenic
918215492 1:182389920-182389942 GGTGGGAAGTAGGATTTGGCCGG - Intronic
918305249 1:183240121-183240143 AGTGAGATGAGGGAAGTGGAAGG + Exonic
918494509 1:185118875-185118897 AGTGGGGGGAAGGGGGTGGAGGG - Exonic
918496962 1:185150948-185150970 AAATGGAAGAAGGAAGTGGAAGG + Intronic
918589500 1:186224344-186224366 AGTGGGAAAAAGGATTTGTGAGG + Intergenic
918952753 1:191160700-191160722 AGAGGGGAGAGGGATGGGGAGGG + Intergenic
919064918 1:192682630-192682652 ATTGGCAAGTAGGAGGTGGAAGG - Intergenic
919098921 1:193069652-193069674 ATTGGGAAGAAGGGTGGGTAAGG + Intronic
919124253 1:193377096-193377118 AGTGGGAAGGAGGTTATGCATGG - Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919806643 1:201384585-201384607 AGATGGAACAAGGATGGGGAAGG - Intronic
920219566 1:204386874-204386896 ATTGGAAAACAGGATGTGGATGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920413137 1:205778154-205778176 AGTAAGAGGAAGGATGTGGCAGG - Intergenic
920465397 1:206179868-206179890 AATGGGAAGAAGGTTTTGAAGGG + Intergenic
920571173 1:207019091-207019113 AGTGGGAAGCATGATCTGGCAGG - Exonic
920822615 1:209395503-209395525 AGTGGCAAAGAGGATGTGGAGGG + Intergenic
920940457 1:210477338-210477360 AGTGGGAAGAAGGCAGAGAAGGG - Intronic
921098613 1:211909286-211909308 AGTGAGGAGAAGGCTGTGCATGG - Intergenic
921199186 1:212789010-212789032 AGAAGGAAGAGGGATGGGGAAGG + Intronic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
921790031 1:219279209-219279231 TGTGGGAAGAGGAATGTGGGTGG + Intergenic
922341053 1:224655396-224655418 AGGGTGAAGAGGGATCTGGAAGG + Intronic
923083690 1:230684883-230684905 CGTGGCATGAAGGATGTGGTAGG + Intronic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923854209 1:237828529-237828551 TGTGGGAAGGAGGAGGGGGAAGG + Intronic
923972181 1:239216917-239216939 ATTTGGAAGAATGAGGTGGAAGG + Intergenic
1062793734 10:326392-326414 GGTGGGGAGAGGGAGGTGGAGGG + Intronic
1062829154 10:593767-593789 AGAGGGGAGACGGATGTGGATGG - Intronic
1063057044 10:2517030-2517052 AATGGAAAGAAGGAGGGGGATGG - Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063505440 10:6593824-6593846 ACTGGGAAGAGGGATGGGGAGGG - Intergenic
1064469603 10:15622266-15622288 AGTGGGAAGAAGGAAGCAGGAGG - Intronic
1065276993 10:24095510-24095532 AGTGGGAGGAAGGCTGGAGAGGG - Intronic
1066551362 10:36561351-36561373 AACGGGCAGAAGAATGTGGAAGG - Intergenic
1067038357 10:42934943-42934965 AGTGGGGAGGAGGAAGTGGTGGG + Intergenic
1067557932 10:47285372-47285394 AGAGGAAAGAAGGCAGTGGAGGG + Intergenic
1067717266 10:48699144-48699166 AGAGGGAAGTGGGAGGTGGAGGG + Intronic
1068444141 10:57098318-57098340 AGTGGAAAGAACGACTTGGAGGG - Intergenic
1069170314 10:65219707-65219729 TCTGGGAAGAAGGGTATGGAAGG - Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069790742 10:71018926-71018948 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1070012107 10:72485785-72485807 AGTGGGGAGAAGAAAGTGAAAGG + Intronic
1070730089 10:78821095-78821117 CGTGTGAAGAAGTCTGTGGAGGG - Intergenic
1070739812 10:78895425-78895447 AGTGGAAGGAAGGAAGTGGAAGG + Intergenic
1070964767 10:80523147-80523169 AGTGGGATAAAGCATGAGGAGGG - Exonic
1071402118 10:85283640-85283662 AGAGGGAATGAGGAAGTGGAAGG + Intergenic
1071923424 10:90377252-90377274 AGTGGGAACAAGGGAGAGGAAGG + Intergenic
1072213512 10:93268611-93268633 AGAGGGATAAAGGATGGGGAGGG - Intergenic
1072231482 10:93417670-93417692 AGTGGGATGATGGAGGTGGGGGG - Intronic
1072728172 10:97827574-97827596 AGAGGGAGGAAAGATGGGGAGGG - Intergenic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073832705 10:107404294-107404316 CCTGGGAAGAATGATGTGGAGGG - Intergenic
1074878709 10:117634629-117634651 AGTGGGAAGTAGGATAGGGAAGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075236312 10:120732921-120732943 AGTAGGCAGAAGAAAGTGGAAGG + Intergenic
1075918685 10:126191483-126191505 ACTGGGAAGGAGGAGCTGGATGG + Intronic
1076146522 10:128126408-128126430 GGCTGGAAGAAGGAAGTGGAGGG - Intergenic
1076305754 10:129464872-129464894 GGTGGGAAGAACTATGTGAAGGG - Intergenic
1076570412 10:131429062-131429084 CTTTGGAAGAAGGATCTGGAAGG + Intergenic
1076733601 10:132449485-132449507 AGGTGGAGGAAGGAGGTGGAAGG + Intergenic
1076987997 11:253243-253265 AGTGGTGACAAGGATGTGGATGG - Intergenic
1077315383 11:1917373-1917395 AGTGGGGAGCAGGCTGTGGGAGG - Intergenic
1078107146 11:8365623-8365645 AGTGGGTAGGTGGAGGTGGAGGG - Intergenic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1078475955 11:11630351-11630373 AGTGGGAAGAGGCAAGAGGAAGG - Intergenic
1079081135 11:17414476-17414498 GGAGGGAGGCAGGATGTGGAGGG - Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080827095 11:35857624-35857646 TGTGGGAACTTGGATGTGGAAGG - Intergenic
1080879185 11:36303094-36303116 TGTGTGGAGAAGGAAGTGGAGGG + Intronic
1081336902 11:41877753-41877775 AGGGGGAAGATTGATTTGGAGGG + Intergenic
1081483929 11:43513426-43513448 ACTTGGAAGAAGGCTGTGGTAGG - Intergenic
1081804327 11:45882141-45882163 AGTGGGAAGGAAGAGGTGGGAGG - Exonic
1081850384 11:46271625-46271647 AGTAGGAAGAAGGATGGAAATGG - Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083799273 11:65037035-65037057 AGTGGGAAGAAGGAATGGGAGGG + Intronic
1084628605 11:70329817-70329839 ACTGGGAAGATTGAGGTGGAAGG + Intronic
1085107592 11:73859069-73859091 AGTGGGTAGAGGGATGTATATGG + Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085505393 11:77056004-77056026 TGTGGGAAGAAAGGAGTGGAGGG + Intergenic
1086834208 11:91601024-91601046 TTTGGGAAGACGTATGTGGATGG + Intergenic
1087554448 11:99697275-99697297 AGTGTGGAGAAGGATGGGGTTGG + Intronic
1087579489 11:100033930-100033952 TGAGGAAAGAAGGATGTGTATGG - Intronic
1088212637 11:107473540-107473562 AGTAGGTAGAAGAAGGTGGAAGG - Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088685060 11:112277907-112277929 AGTGGAAAGAATTATGTGGAAGG + Intergenic
1089048785 11:115527813-115527835 TGTAGAAAGAAGGAAGTGGAAGG + Intergenic
1089084216 11:115803169-115803191 AGGAGAAGGAAGGATGTGGATGG - Intergenic
1089299690 11:117491097-117491119 TGTGGGAAGGAGGATGTTGAAGG + Intronic
1089706754 11:120283642-120283664 AGTGGGGAGAAGGGAGTGGGTGG - Intronic
1089715219 11:120352934-120352956 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090209404 11:124907423-124907445 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090982917 11:131739146-131739168 AGTGTGAGGAAGGATTTAGAGGG - Intronic
1091093284 11:132793078-132793100 AGTGGGGAGAATGATGGGGCCGG - Intronic
1091121309 11:133060212-133060234 GATGGGGAGAAGGAGGTGGAGGG - Intronic
1092283772 12:7116797-7116819 AGTGGGCAGAAGAATGGGGTTGG - Intergenic
1092296285 12:7201685-7201707 AGTGGGGAGTAGCATGGGGAGGG + Intronic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092889591 12:12956286-12956308 AGAGGGAGGAAGGAAGGGGAAGG - Intergenic
1093292287 12:17342685-17342707 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1093510064 12:19916375-19916397 AGGTGGAAGAAGGATGTGTTTGG - Intergenic
1094046599 12:26174453-26174475 CGTGGGTAGCAGGATGGGGAAGG - Intronic
1094214591 12:27927211-27927233 AGAGGAAAGAAGAAAGTGGAAGG + Intergenic
1094583230 12:31753825-31753847 AGAGAGAAAAAGGAGGTGGAAGG + Intergenic
1094604344 12:31937714-31937736 AGCAGGCAGAAGAATGTGGAGGG + Intergenic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1095092009 12:38116328-38116350 AGTGGCAATAAAGATGTTGATGG + Intergenic
1095400841 12:41813598-41813620 AGTGGGAGGAAAGATGGGCAGGG + Intergenic
1096584531 12:52611196-52611218 AGTGTGAAGAAGCAGGTGAAGGG - Exonic
1097077082 12:56403034-56403056 ACTTGGAAGAGGTATGTGGATGG + Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097371145 12:58782899-58782921 GGCAGGCAGAAGGATGTGGAAGG + Intronic
1097649552 12:62280275-62280297 AGTGGGGAGAGGGTTATGGAGGG + Intronic
1097892168 12:64788170-64788192 AGAAGGAAGAAGGGTGTGTAGGG + Intronic
1097921766 12:65083618-65083640 CTTTGGAAGAAGGATGTGAATGG - Intronic
1098059316 12:66543157-66543179 TGGGGGAAGAAGGCTGGGGACGG + Intronic
1098102016 12:67027948-67027970 AGAGGGCAGATGGATGTGGGTGG + Intergenic
1098425187 12:70355930-70355952 AGTAGGAAGAAAAATGTGGAAGG + Intergenic
1098971041 12:76857317-76857339 AGTGGGAGGAAGTTGGTGGAGGG - Intergenic
1099689864 12:85938653-85938675 TTAGGGAAGAAGTATGTGGATGG + Intergenic
1099697775 12:86043494-86043516 AGCAGGTAGAAGAATGTGGAAGG - Intronic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100184161 12:92120831-92120853 AGTGGGAACATGGATGTTCATGG - Intronic
1101124324 12:101615349-101615371 AGGAGGAAGAGGGATGAGGAAGG - Intronic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101296103 12:103425065-103425087 ACTGGGAAGTAGGAACTGGACGG + Intronic
1101296234 12:103425863-103425885 ACTGGGAAGTAGGAACTGGACGG - Intronic
1101615454 12:106332090-106332112 AGTGGTAAGCTGGATGTGGTCGG + Intronic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1102073942 12:110045024-110045046 AGGGGGAAGAAGGAAGGAGAAGG + Intronic
1102649521 12:114429182-114429204 AGTTGGATGAAAGATGTGAAGGG + Intergenic
1102804971 12:115771662-115771684 AGTGGGAAGAAGTACGGTGATGG + Intergenic
1102902245 12:116647433-116647455 AGAGGGAAGAAGGAAGGGAAGGG - Intergenic
1103780112 12:123392845-123392867 AGGAGGAAGAAAGATCTGGATGG + Intronic
1103948749 12:124540739-124540761 AGTGGGGAGATGGAGGGGGATGG + Intronic
1104252997 12:127113702-127113724 AGTGGGGAGAAGGAGGTAGAAGG + Intergenic
1105927396 13:25019680-25019702 AGTGGGATAAAGGATGGGAAAGG + Intergenic
1106224948 13:27778232-27778254 AGTGGGAAAAAGAAGGTGGTGGG + Intergenic
1106464937 13:30005116-30005138 ATTGGGCAGAAGGATGGAGAAGG + Intergenic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1107089702 13:36464710-36464732 ATTGGGAAGTAGGATATGGAAGG + Intergenic
1107157250 13:37183407-37183429 AGTGCTGAGAAGGATGTCGATGG - Intergenic
1107597121 13:41974457-41974479 AGTGTGAAGAAAGGTGTGGAGGG + Intergenic
1108185047 13:47880383-47880405 AGAGGGAAGGAGGATGGGGTGGG + Intergenic
1108319938 13:49279712-49279734 ACAAGGAAGATGGATGTGGAAGG + Intronic
1108446179 13:50511090-50511112 AGCAGGCAGAAGAATGTGGAAGG + Intronic
1108547161 13:51507595-51507617 AGTGAGATGAAGGTTGTAGAAGG - Intergenic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1109713124 13:66184616-66184638 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1110490141 13:76093882-76093904 AGTGTGAAGAAGGGTGTAGAGGG - Intergenic
1110738229 13:78963502-78963524 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1111792248 13:92872173-92872195 AGTGGAAAAAAGGATTTTGAAGG - Intronic
1111913980 13:94342105-94342127 AGTGAGAAGAAGCATCTGGGAGG - Intronic
1113116035 13:106875774-106875796 AGTGAGAGGAAGCCTGTGGAGGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113278455 13:108761554-108761576 ATTGGGAAAAATGATATGGAAGG + Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113811886 13:113147674-113147696 AGTGGGGAGGAGGACGGGGAGGG + Intronic
1113815185 13:113164692-113164714 AGAAGGAAGGAGGATGTGGACGG - Intronic
1114519824 14:23326051-23326073 AGTGGGAACAGGGAGGTGGGAGG + Exonic
1114742532 14:25112771-25112793 AAAGGGAAAAAGGATGTGGAAGG - Intergenic
1115068426 14:29294033-29294055 AGTAGGCAGAAGAATTTGGAAGG - Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116865031 14:50024954-50024976 AGTGGGTAGAAGGATCTGGAAGG + Intergenic
1117995854 14:61477827-61477849 AGAGGGTCGAAGGAGGTGGAAGG - Intronic
1118127239 14:62920193-62920215 CTTAGGAAGAATGATGTGGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119690075 14:76664834-76664856 AGTGGGGAGTAGGGTGTGGCAGG - Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120811739 14:88811027-88811049 TGTGGGAAAAAGGAAGTTGAGGG + Intergenic
1121277329 14:92677258-92677280 AGTGGGTGGGAGGATGTGGTGGG - Intronic
1123117643 14:105901879-105901901 GGTGGGCAGACGGCTGTGGACGG - Intergenic
1123772060 15:23538879-23538901 AATGGGCAGCTGGATGTGGAAGG - Intergenic
1123976208 15:25556743-25556765 GCCTGGAAGAAGGATGTGGATGG + Intergenic
1124327190 15:28776708-28776730 AGTGGGAAAAAAGAAATGGAGGG - Intergenic
1124511562 15:30331662-30331684 AGTGGGACCAAGGACGTGGGAGG + Intergenic
1124529185 15:30488597-30488619 AGGGGGAAGAAGGAAATGGAGGG - Intergenic
1124602750 15:31148765-31148787 TGTGGGGAGAAGGAGGTGGCTGG + Intronic
1124769477 15:32519096-32519118 AGGGGGAAGAAGGAAATGGAGGG + Intergenic
1125282226 15:38054803-38054825 TGTAGGAAGAAGGATGTGTGTGG - Intergenic
1125431595 15:39600457-39600479 AGTGGGAAGAAGGAAAAGCAGGG + Exonic
1126396954 15:48228328-48228350 AGTGGGAAGAAAAGTGGGGAGGG - Intronic
1129293122 15:74583844-74583866 AGTGGGCAGTTGGAGGTGGAAGG + Intronic
1129681800 15:77662352-77662374 AGAGGGAGGAAGGATGGGGTTGG + Intronic
1130056820 15:80533293-80533315 AGTGTGGAGCAGGAAGTGGAAGG + Intronic
1130066382 15:80608372-80608394 AGCAGGCAGAAGAATGTGGAAGG + Intergenic
1131509047 15:93039057-93039079 AGCGGGCAGAGGAATGTGGAAGG + Intronic
1131724320 15:95205338-95205360 AGCAGGTAGAAGAATGTGGAAGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132716068 16:1290381-1290403 AGCGGGGAGAGGGCTGTGGACGG - Intergenic
1133109248 16:3535980-3536002 AGTGGCAAGCAGGCTGTGGGAGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133460706 16:5984077-5984099 AGTGGGAGGGAGGAGGAGGAGGG - Intergenic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133710000 16:8392141-8392163 GGTGGGAAGAAGGAAGGAGAGGG - Intergenic
1134208134 16:12254047-12254069 AGCAGCCAGAAGGATGTGGAGGG + Intronic
1135632163 16:24044949-24044971 TGTGTGAAGAAAGGTGTGGAAGG + Intronic
1135964037 16:27021300-27021322 AGTGAGAGGAAGGATGGGGGAGG - Intergenic
1135982557 16:27159628-27159650 AGAGGGAATGGGGATGTGGATGG - Intergenic
1136393585 16:29980468-29980490 GGTGGGAGGAAGGATGGGGATGG - Intronic
1136620160 16:31423288-31423310 GGAGGGAAGTAGGATTTGGAAGG + Intronic
1137504038 16:49035637-49035659 AGAGGGAAGAGGGATGGGAAAGG - Intergenic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1138416876 16:56876657-56876679 GGTGGGAGGGAGGATGTGGCAGG - Intronic
1139064812 16:63299887-63299909 AGTGAAAAAAAGGATGTGGCCGG + Intergenic
1139271426 16:65687059-65687081 ACTGGGAAGCAAGATCTGGAGGG + Intergenic
1139893600 16:70270467-70270489 GGTGGGAAGAGGGAAGTGGAGGG + Intronic
1139905451 16:70362552-70362574 GGGTGGGAGAAGGATGTGGAAGG - Intronic
1140407668 16:74721784-74721806 AGTTGGGGGAAGTATGTGGAGGG - Intronic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1142099650 16:88264570-88264592 AGGGGGGAGGAGGATGTGGGAGG - Intergenic
1142109648 16:88324344-88324366 GGTGGGTGGAAGGATGTGGGGGG + Intergenic
1142278162 16:89133699-89133721 GGTGGGGAGAAGGATGTGGAGGG - Intronic
1142321933 16:89388788-89388810 CCTGGGAAGAAGGTTCTGGAAGG + Intronic
1142501415 17:335272-335294 AGTGGGAAGGAGGCGGCGGACGG + Intronic
1142741340 17:1933452-1933474 AGTGGGAAGATGGCAGCGGAGGG + Intergenic
1142915369 17:3132175-3132197 AGAGGGAATAAGGATGTGGTGGG + Intergenic
1143131991 17:4684620-4684642 AGTGGGAAGAGTCATGTGGTGGG - Intronic
1143137728 17:4721047-4721069 GGTGGGAAGAAGGGAGGGGATGG + Exonic
1143176245 17:4956804-4956826 TGAGGGAAGAAGAATTTGGAGGG - Intronic
1143373782 17:6455693-6455715 AGGGGGAAGAAGGGAGGGGAGGG + Intronic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143476416 17:7205984-7206006 GGTTGGAAGATGGATGTTGAAGG - Intronic
1143553516 17:7646353-7646375 AGTGGGTTTGAGGATGTGGACGG - Intergenic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1144150305 17:12436587-12436609 AGTAGCAGGAAGGCTGTGGAGGG - Intergenic
1144574790 17:16422575-16422597 TGTGGGAAGAAGGGAGGGGAAGG - Intronic
1146453959 17:32995273-32995295 GGTGTGAAGCAGGATGGGGAAGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146763249 17:35496481-35496503 AGTCGGAAGAAGGAAGGGTAGGG - Intronic
1146962325 17:36993263-36993285 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1147361565 17:39933947-39933969 GGTGGGAAGAAGGAGGGGGAGGG + Intergenic
1147429253 17:40361695-40361717 AGTAGGAAGAAGGGGGTGGTTGG + Intronic
1147498808 17:40942517-40942539 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147498859 17:40942810-40942832 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147905136 17:43817881-43817903 GGTGGGAAGTAGGAGGTGGGGGG - Intronic
1148358946 17:46996082-46996104 AGTGGGAAGCAGGGAGTGGGAGG - Intronic
1148451906 17:47784061-47784083 AGATGGAAGAAGGATGTGTTGGG - Intergenic
1148492499 17:48032351-48032373 ACTGGGAAGGAGAATGTGAAGGG + Intronic
1149013590 17:51883336-51883358 AGTGGGAAGAGTGATCAGGAGGG - Intronic
1149091714 17:52790910-52790932 ACAGGGAAGAAGGATATGGGTGG - Intergenic
1149658116 17:58320717-58320739 AGAGGGAAGAGGGATAGGGAAGG + Intronic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1151203860 17:72490478-72490500 AGTGGGTAGAAGGCTGGGGGAGG + Intergenic
1151825000 17:76519238-76519260 AGGTGGAGGAAGGATGTGGGGGG - Intergenic
1152056128 17:78028271-78028293 AGTGGGAACAAGGAGGTAGAGGG + Intronic
1152267843 17:79306635-79306657 AGTTGGCAGAAGGATGTGAGAGG + Intronic
1152432146 17:80254406-80254428 AGTGAGAAGAAAGGGGTGGAGGG - Intergenic
1153226419 18:2903416-2903438 CGTGGGAAGAAGGATGGGGAAGG - Intronic
1153706267 18:7748747-7748769 AGTGGCAAGGAGGATTTGGGGGG - Intronic
1154036724 18:10810502-10810524 AGTAGGGAGTAGGATGAGGAGGG - Intronic
1154355779 18:13622338-13622360 AGTGGGGAGAAGGAAGGGGTGGG + Intronic
1156284682 18:35680102-35680124 AGAGGGAAGAAGTATGGGAATGG - Intronic
1157710895 18:49848984-49849006 TGAGGGTGGAAGGATGTGGAGGG + Intronic
1157822281 18:50781548-50781570 AGGGGAAAGAAGGAAGTGAATGG - Intergenic
1158220833 18:55149125-55149147 TGTGGGAAGAAGGATTATGAAGG + Intergenic
1158423591 18:57319061-57319083 GGAGGCCAGAAGGATGTGGAGGG - Intergenic
1158446387 18:57526025-57526047 AGAGGGAAGAAGACGGTGGAAGG + Intergenic
1159040501 18:63319767-63319789 GGTGGGGAGAAGGAGGTGGTGGG + Exonic
1159133560 18:64309406-64309428 AGTGGCATGAAGTAAGTGGATGG - Intergenic
1159207650 18:65274201-65274223 AATGGGGAGAAGGATGTAGGTGG + Intergenic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159642614 18:70881245-70881267 AGTGGAAAAAAGGATCTGCAGGG + Intergenic
1160452770 18:78977281-78977303 AGTGGGAAGATGGAGGAGGCCGG - Intergenic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160676406 19:393672-393694 GGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695266 19:480905-480927 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695278 19:480955-480977 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695290 19:481032-481054 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695306 19:481120-481142 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695321 19:481182-481204 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160695360 19:481383-481405 TGTGGGAAGGATGATGGGGAAGG + Intergenic
1160830705 19:1103856-1103878 AGTGGGAAGAAGGCGGGGAAGGG - Intergenic
1161091222 19:2360999-2361021 GGTGGGAACAGGGATGGGGAGGG - Intergenic
1161196386 19:2988850-2988872 AGAAGGCAGAAGTATGTGGAGGG + Intronic
1161966205 19:7550587-7550609 AGTGGCAAGAAGGAGCTGGTGGG + Exonic
1162018313 19:7857306-7857328 AGTGGGGAGAAGGGTGTGTGTGG + Intronic
1162062169 19:8102693-8102715 GCTGGGAAGAAGGTTGGGGAGGG + Intronic
1162232795 19:9281627-9281649 AGGGTAAAGAAGGATGGGGAAGG + Intergenic
1163253330 19:16139851-16139873 AGAGGAAGGAAGGGTGTGGAGGG - Intronic
1163290814 19:16377917-16377939 TGTGGGGTGGAGGATGTGGATGG - Intronic
1163453977 19:17395200-17395222 AGTAGGAGGAAGGAAGGGGAGGG - Intergenic
1164675895 19:30101214-30101236 AGCTGGGACAAGGATGTGGATGG + Intergenic
1164682840 19:30147145-30147167 ACTGGCAAGAAGGATATGGTTGG - Intergenic
1164861499 19:31565542-31565564 ATTGGGAAAAAGAGTGTGGATGG + Intergenic
1164996023 19:32720650-32720672 GGTGGGAATAAGGATGGGGTGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165767625 19:38361062-38361084 TGTGGCAAGAAGGGTGAGGAAGG + Intronic
1165840937 19:38788954-38788976 AGTGGGAAGACAGGGGTGGAGGG + Intergenic
1167509158 19:49887296-49887318 AGTGGGAGGAAGGAGGGGCAGGG + Intronic
1167561931 19:50231233-50231255 AGTGGGAACCTGGATGAGGAGGG - Intronic
1167570908 19:50288490-50288512 TGTGGGAAACAGGATGTTGATGG + Intronic
1168283688 19:55320175-55320197 AGAGGGGAGAAGGAAGTGGGAGG + Intronic
1168418264 19:56183252-56183274 AGGGGGAACAAGGAAGTGGCAGG + Intronic
1168419680 19:56193236-56193258 ATTGGGATGAGGGATTTGGAAGG - Intronic
1168421288 19:56205710-56205732 ATTGGGATGAGGGATTTGGAAGG + Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925345807 2:3171122-3171144 GGTGGCAAGAAGGATGGTGAGGG - Intergenic
925640340 2:5981078-5981100 AGTGGGAGAAAGGAAGGGGAGGG + Intergenic
925920331 2:8633639-8633661 AGGGGGACGAAGGAGGGGGAAGG - Intergenic
926651847 2:15355222-15355244 AGTGGGTAGAAAGATGTGTTTGG + Intronic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
926976015 2:18517530-18517552 AGTGGGGAGCAGGGTGGGGAGGG - Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927686390 2:25174349-25174371 AGAGGGAGGAAGGAAGTAGAAGG + Intergenic
927709406 2:25315342-25315364 AGTGGGAGGAAGGAGCTGGCAGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928642799 2:33318308-33318330 AGTGGGAAGTAGGTGGTGGGTGG + Intronic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
928796857 2:35033830-35033852 AGTGGGCAGAATGAGCTGGATGG - Intergenic
928831155 2:35485388-35485410 AACGAGATGAAGGATGTGGAAGG + Intergenic
929389939 2:41458527-41458549 AGTGGGAAGGAGTCTGAGGAGGG + Intergenic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930249427 2:49018757-49018779 AGTGGGTAGAAGGAAGTAAAAGG + Intronic
930480855 2:51946720-51946742 AGCAGGAAGAAGAAAGTGGAAGG - Intergenic
930620386 2:53637496-53637518 TGTGGGAAGAATGAATTGGAGGG - Intronic
930723016 2:54655966-54655988 AGTGGGAAGACCGATGGGAATGG + Exonic
932195205 2:69777197-69777219 AGTGGGAAATAGGGAGTGGAGGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932891259 2:75598935-75598957 AAGGGCAAGAATGATGTGGAAGG - Intergenic
933273053 2:80254290-80254312 TGTGGGCAGAAGCATGTGGTAGG - Intronic
934108821 2:88722896-88722918 AGGGGGAAGAAGGAGGTATAGGG + Intronic
934768659 2:96894566-96894588 AGTGGGTAGGTGGATGTGGGTGG - Intronic
934881611 2:97986352-97986374 AGAGGGAAGAGAGATGAGGAAGG + Intronic
935184030 2:100715526-100715548 CTAGGGAAGAAGTATGTGGATGG + Intergenic
935438838 2:103067904-103067926 AGGGGCAAGAGGTATGTGGATGG + Intergenic
935494666 2:103765416-103765438 TGTGGGCAGAAGGATGAGGGAGG - Intergenic
936861196 2:117022575-117022597 AGTGGGAAGATTGATGAGTAGGG + Intergenic
937315969 2:120932327-120932349 AGTGGAAAGCAGGAGGTGCAAGG - Intronic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938000049 2:127726391-127726413 GGTGGGGAGGAGGATGAGGAGGG - Intronic
938769427 2:134488360-134488382 AGCAGGCAGAAGAATGTGGAAGG + Intronic
938950987 2:136254315-136254337 AGTGGGGGGAGGGAGGTGGAGGG - Intergenic
939159358 2:138567979-138568001 AGTGGGAGGTAGGAAGTGGGGGG + Intronic
939337445 2:140848671-140848693 ATTTGGTAGAAGGATTTGGAGGG - Intronic
939623226 2:144446311-144446333 GGAGGAAGGAAGGATGTGGAAGG - Intronic
939673104 2:145038015-145038037 GGTGGGAAGAAGGATGTGTAAGG + Intergenic
939992608 2:148889433-148889455 AGAGGGAGGAAGGACTTGGAGGG + Intronic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940424687 2:153516945-153516967 AGAGTGGAGAAGGAGGTGGAAGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940841617 2:158589392-158589414 AGTGGCAAGAAGGAGGTAAATGG - Intronic
941381854 2:164802846-164802868 AGAGGGAGGAAGGAAGGGGAGGG + Intronic
941631026 2:167884365-167884387 AGAGGGAAGAAGGAGGAGGGAGG - Intergenic
941642031 2:167999091-167999113 ATTGGGAATAAGGATGGGGAGGG - Intronic
941829067 2:169934212-169934234 ATTGGGAAGAAGCATTTGCATGG + Intronic
942616144 2:177793807-177793829 AGTCAGTAGAAGGATGGGGAGGG + Intronic
943100910 2:183485027-183485049 AGCAGGGAGAAGAATGTGGAAGG + Intergenic
943637830 2:190325795-190325817 ACTGGGAAGACTGAAGTGGAAGG - Intronic
944506849 2:200421282-200421304 GGTGGTAAAAAGGATTTGGAGGG + Intronic
944542752 2:200769184-200769206 CGTGGGAGTAAGGATGGGGATGG - Intergenic
944614419 2:201445737-201445759 AGTGGGAAGAATTATGGGGAAGG + Intronic
944834959 2:203570223-203570245 AGTGAGAAGATGGCTGTGGCTGG - Intergenic
945028653 2:205643258-205643280 AGTGGGAAGAAGGAGAGAGAGGG - Intergenic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945639141 2:212400245-212400267 AGTGGGGAAGAGGATTTGGAAGG + Intronic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
946346934 2:219118466-219118488 AGTGGGAAGATGGAGGGGGAGGG + Intronic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946569715 2:221010339-221010361 AGCAGGCAGAAGAATGTGGAAGG + Intergenic
946712150 2:222517453-222517475 AGTTGGAAGGGGGATGTGGTGGG - Intronic
946901512 2:224377377-224377399 AGCAGGCAGAAGAATGTGGAAGG + Intergenic
946917540 2:224540420-224540442 GGAGGGAAGAAGGAAGAGGAAGG + Intronic
946941854 2:224777422-224777444 AGTAGGCAGAGGAATGTGGAAGG + Intronic
947005415 2:225505881-225505903 AATGGGAAGAAGGATGAAGCAGG + Intronic
947007076 2:225524353-225524375 AGCAGGTAGAAGAATGTGGAAGG - Intronic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947212404 2:227720092-227720114 TGTGGGGAGAAGGCTGTGGATGG + Intergenic
947464348 2:230327682-230327704 AGAGGGCAGAGGGATGTGAAAGG - Intronic
947921052 2:233874586-233874608 AGCAGGCAGAAGAATGTGGAAGG + Intergenic
948285312 2:236779816-236779838 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
948458678 2:238118891-238118913 AGTTGGACGGAGGAGGTGGATGG + Intronic
948458776 2:238119273-238119295 AGTTGGACGGAGGAGGTGGATGG + Intronic
948458785 2:238119314-238119336 AGTTGGATGGAGGAGGTGGATGG + Intronic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
1168821015 20:773937-773959 AGAGGGCAGGAGAATGTGGAGGG - Intergenic
1168914579 20:1475734-1475756 AGTGGGGAGAAAGGTGTAGATGG + Exonic
1170080424 20:12468907-12468929 ACTGGGTAGAGGGATGTAGAGGG - Intergenic
1170445606 20:16424272-16424294 GGTGGGTGGATGGATGTGGATGG + Intronic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170598853 20:17825431-17825453 AGTCTGAAGAAGGATGAGGGTGG + Intergenic
1170701258 20:18705647-18705669 AGTGGGAAGGATGAGCTGGACGG + Intronic
1170803479 20:19610168-19610190 AATGATAAGAAGGAAGTGGAAGG - Intronic
1170957411 20:20993851-20993873 GGAGGGAAGAAGGATGGGGAGGG + Intergenic
1172298348 20:33830114-33830136 AGTGCTCAGCAGGATGTGGAAGG + Intronic
1172630053 20:36372157-36372179 AGTGAGTAGAAACATGTGGAGGG + Intronic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1173132548 20:40408285-40408307 AATGGGAAAAAGGAGATGGAAGG + Intergenic
1173167878 20:40698762-40698784 GGAAGGAAGGAGGATGTGGAAGG + Intergenic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173571744 20:44081597-44081619 AGTGGGCAGAAGGCTGTGACTGG - Intergenic
1173759888 20:45550145-45550167 AGTGGGAAGATGGTTGAGCAGGG + Intergenic
1173799954 20:45888875-45888897 TGTGGGAAGAAGACTGTGAAAGG + Intronic
1174140370 20:48408841-48408863 AGTGTGTAGAAAGTTGTGGAAGG - Intergenic
1174276614 20:49408917-49408939 AATGGGAACGCGGATGTGGAGGG + Intronic
1174509589 20:51041026-51041048 TGGGGGAAGGAGGAAGTGGAGGG - Intergenic
1174519361 20:51118013-51118035 AGTGGGGGGAATGATGTGGCTGG + Intergenic
1175185892 20:57179455-57179477 GGTGGGGAGAAGGAAGTGCAGGG + Intronic
1175259038 20:57663441-57663463 AGTGGGCAGCAGGATGTGCGGGG + Intronic
1175328331 20:58145418-58145440 ATTGGGTAGAAGCAGGTGGAAGG - Intergenic
1175334603 20:58187165-58187187 CGTGGGAGGAGGGATTTGGATGG - Intergenic
1175474330 20:59259649-59259671 AGTGGGATCGAGGATATGGAAGG + Intergenic
1175834513 20:61984970-61984992 AGGGGGAGGACGGATGTGGTGGG + Intronic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1178011488 21:28291441-28291463 AGCTGGCAGAAGAATGTGGAAGG - Intergenic
1178230878 21:30783094-30783116 AGAGGGAAGAGGTATATGGAAGG - Intergenic
1179353542 21:40636397-40636419 AGAGGGAAGAAGGAAGGGGGTGG + Intronic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179417662 21:41211166-41211188 AGGGGGGAGAGGGATGGGGAGGG - Intronic
1179473235 21:41626025-41626047 AGAGGGAAGGAGGATGGGCAGGG + Intergenic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1180049403 21:45324444-45324466 GGTGGGGTGAAGGATGTGGAGGG + Intergenic
1181149778 22:20874986-20875008 AGAGGTATGTAGGATGTGGAAGG - Intronic
1181506373 22:23360991-23361013 AGTGGGAAGTAGATTGTGCAAGG - Intergenic
1182330645 22:29549419-29549441 AGTGTGGAGCAGGATGTGGGTGG - Intronic
1182499230 22:30733433-30733455 AGTGGGAAATGGGAAGTGGATGG - Intronic
1182794993 22:32985471-32985493 AATAGGAGGAAGGATGTGAAGGG - Intronic
1183350378 22:37331497-37331519 AGAGGGAACAGGGATGGGGAAGG - Intergenic
1183371009 22:37432406-37432428 AGTGGGGGGAAGGAGGTGGTAGG - Intergenic
1183780685 22:39996888-39996910 AGAGGGAAAAAGGATGTAGGCGG + Intronic
1184075728 22:42176295-42176317 AAGGGCAAGAAGGATGTGAAAGG + Intronic
1184144811 22:42603542-42603564 AGTGAGAACATGGATGGGGATGG - Intronic
1184570357 22:45319802-45319824 AATGGGAAGAAGGATGTGTTAGG + Intronic
1184821943 22:46915955-46915977 CTTGGAAAGAAGGATGTGGTGGG + Intronic
1185004613 22:48268426-48268448 AGTGGGACGAAGGTTCTGGGTGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949269602 3:2199254-2199276 ACTGGGAAGAAGGAAGTAGAGGG - Intronic
949850220 3:8413215-8413237 AAAGGGAAGAAGGAAGTGAAAGG + Intergenic
950115588 3:10448674-10448696 AGTAGGAAGATGGATGTGATAGG - Intronic
950120198 3:10476644-10476666 GGAGGGAGAAAGGATGTGGATGG + Intronic
950376895 3:12579729-12579751 GGTGTGTAGAAGGATGTGGTGGG + Intronic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
951104570 3:18727980-18728002 AGTGGGAAAAGGGATGGGTAGGG + Intergenic
951400682 3:22228783-22228805 AGCAGGCAGAAGAATGTGGAAGG + Intronic
951621833 3:24610258-24610280 TGTGTGAAGAAGGAGGAGGATGG + Intergenic
951856300 3:27200895-27200917 AGTGGGAAGCACCATGTGGCTGG + Intronic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
951972156 3:28458804-28458826 AGTTGGAATAAAGATGTGAAAGG + Intronic
952442570 3:33347102-33347124 TGAGGGCAGGAGGATGTGGAGGG - Intronic
953727420 3:45412410-45412432 AGTGGGGAGATAGATGTGGAAGG + Intronic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
955450270 3:59058624-59058646 AGTGGGAAAAAGGCAGTAGAAGG + Intergenic
956025164 3:64975640-64975662 AGTGGCCAGTAGGATGTGGTTGG + Intergenic
956318572 3:67968673-67968695 AGTGAGAAAATGGATATGGATGG + Intergenic
956338861 3:68196891-68196913 AATGGCCAGAAGGATGTGGTTGG - Intronic
956543949 3:70378442-70378464 TATAGGAAGAAGGATGAGGAAGG + Intergenic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
957199206 3:77110800-77110822 ACTGGGAAGACTGAGGTGGAAGG - Intronic
957467076 3:80608075-80608097 AGTGGGAGGGAGGAGGGGGAAGG + Intergenic
957887638 3:86309745-86309767 AGTGTTAGTAAGGATGTGGAGGG - Intergenic
959237240 3:103740468-103740490 TGTTGGAGGAAGGATGTGGTGGG - Intergenic
959262946 3:104103744-104103766 AGTGGGAATGAGGATGTGTATGG + Intergenic
960083837 3:113569608-113569630 AGTGGTCAGAAGGATGGAGAAGG + Intronic
960192354 3:114722115-114722137 AGTGAGAATAAGGGAGTGGAGGG + Intronic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960531542 3:118771251-118771273 AGCAGGCAGAAGGACGTGGAAGG - Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960708083 3:120500672-120500694 AATGGGAAGAAAGATGTGACAGG - Intergenic
961137634 3:124526624-124526646 AGGAGGAGTAAGGATGTGGAGGG + Intronic
961587993 3:127950282-127950304 AGTGGGAAGAAGGAGATAGAAGG + Intronic
961668501 3:128509204-128509226 CATGGGAAGAAGCATGTGCATGG - Intergenic
961755919 3:129127339-129127361 TGAGGGAAGAAGGAAGTTGATGG + Intronic
962315322 3:134355713-134355735 AGTTGGAATGAGGATGTGGCTGG - Intergenic
962949189 3:140202474-140202496 AGTTGGAGGAAGGATGCGGGTGG + Intronic
964295724 3:155230976-155230998 AGTGGGAAGATGGAAGAGGCTGG + Intergenic
965029110 3:163340838-163340860 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
965550785 3:169962929-169962951 AGTGGGAAGGAGGATGTAATTGG - Intergenic
966107224 3:176350783-176350805 AGTAGGCAGAGGAATGTGGAAGG - Intergenic
966280682 3:178223080-178223102 TGTGGGCAGGAAGATGTGGAAGG - Intergenic
966728597 3:183131411-183131433 AGTTTGAAGGAGGAGGTGGAAGG + Intronic
967074889 3:185993223-185993245 GGAGGGAAGAAGGATGTGCTGGG + Intergenic
967426369 3:189332185-189332207 AGTTGGAAGTAGGAAGTGGTGGG - Intergenic
967580330 3:191145734-191145756 AGTGGGTAGAAGGAGGAAGAGGG - Intergenic
967945317 3:194799370-194799392 TGTGGGAAGGAGGATTTGCAGGG + Intergenic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
969286312 4:6204507-6204529 AGTGGGAGGAAGCATGATGAGGG + Intergenic
969373235 4:6747270-6747292 AGAGGGAAGAAGGGTGCTGAGGG - Intergenic
969870840 4:10103783-10103805 AGTGGGAGGAGGGAGGTGGGGGG - Intronic
970213093 4:13731261-13731283 AGCAGGCAGAAGAATGTGGAAGG + Intergenic
970317674 4:14845106-14845128 AGTGGGGATAGGGATGGGGATGG + Intergenic
970387734 4:15572988-15573010 AGCAGGCAGAAGAATGTGGAAGG - Intronic
970909576 4:21258975-21258997 ACTGGGATGCTGGATGTGGATGG + Intronic
971000915 4:22321677-22321699 GGTGGGAAGAATGTTGTGGGTGG - Intergenic
971192612 4:24441693-24441715 GGAGGGAAGAAGGAAGAGGAGGG + Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
972085306 4:35207726-35207748 TTAGGGAAGAAGTATGTGGATGG + Intergenic
972123938 4:35740428-35740450 AGTAGGCAGAGGAATGTGGAAGG + Intergenic
972471300 4:39407244-39407266 AGTTGGAAGAAGGATGGAAAAGG + Exonic
972561489 4:40232713-40232735 AGTGGGGAGCAGGAAGTGGCCGG - Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973785454 4:54328563-54328585 AGTGGGAAGAAGAGCTTGGAGGG + Intergenic
973844784 4:54900680-54900702 TGTGGGAAGAGGGAGGTGGTGGG + Intergenic
973931404 4:55796294-55796316 AGAGGCAAGAAGCAGGTGGAAGG - Intergenic
974369195 4:60992236-60992258 TGTGGGAAGAAAGCTGTGGGAGG + Intergenic
974695124 4:65357665-65357687 TGTGGGAACAGGGAAGTGGAGGG + Intronic
974895815 4:67937221-67937243 AGTTGGAAGAAAGGTGTGGATGG - Intronic
975687383 4:76930866-76930888 AGTATGCAGAAGGATGTGCATGG - Intergenic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
976018706 4:80593043-80593065 AGTGGGAAAAAGGAATGGGAAGG - Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976634560 4:87274991-87275013 AGTGGGAAAGAGGAAGTGGAGGG - Intergenic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
977423622 4:96836686-96836708 AGTGAGAAAATGCATGTGGAAGG + Intergenic
978176835 4:105742332-105742354 AGTGGGAAGAAGAATATTCAAGG - Intronic
978402071 4:108341583-108341605 AGTGGTAAGAAGGCAGGGGATGG + Intergenic
978755883 4:112302492-112302514 AGGGGGAGGAAGGAAGTTGATGG - Intronic
979084202 4:116385724-116385746 AGTGGCATGCAGGATGTGAAAGG + Intergenic
980206499 4:129725579-129725601 GGTATGAGGAAGGATGTGGAAGG - Intergenic
980774274 4:137419257-137419279 AGTGGGAGGAAGGCTCTTGAAGG - Intergenic
982108896 4:152035113-152035135 GGAAGGTAGAAGGATGTGGACGG + Intergenic
982109827 4:152043913-152043935 AGAGGAAAGAAGGAATTGGAAGG - Intergenic
983281760 4:165690018-165690040 GGTGGGAAGAAGGTTCTGTAGGG - Intergenic
983365382 4:166780490-166780512 GTAGGGAAGATGGATGTGGATGG - Intronic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
983619396 4:169744233-169744255 AATGGGAAGAAGGATGTTTTAGG - Intronic
983798664 4:171899902-171899924 AGAGGGAAGTAGGGTGTGGAAGG - Intronic
984060199 4:174981396-174981418 TTTGGGAAGAGGTATGTGGATGG - Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
985034977 4:185829547-185829569 AGTGGGAACGGGGATGGGGATGG - Intronic
985508416 5:298441-298463 AGTGGGAAGAAGGAGGGGACGGG + Intronic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985631601 5:1016990-1017012 TGTGGGAAGGAGGATGGGGTCGG - Intronic
985652305 5:1112624-1112646 AGGGGGAAGAAGGAGGGGTAGGG - Intergenic
985739630 5:1607227-1607249 AGTGGGAAGAAGGAGGGGACGGG - Intergenic
985927784 5:3031105-3031127 AGTGGAAGGGAGGAAGTGGAAGG - Intergenic
986076554 5:4343895-4343917 AGAGGGAAGAAGGCTGTGTGGGG + Intergenic
986604568 5:9508736-9508758 AGTGGCAGGAGGGCTGTGGAAGG - Intronic
987093174 5:14525448-14525470 CATGGGAAGAAGGATGAGGCAGG - Intronic
987405243 5:17518140-17518162 AGTGTGAAGAAACTTGTGGAAGG - Intergenic
987405688 5:17521574-17521596 AGTGTGAAGAAACTTGTGGAAGG - Intergenic
987406135 5:17525008-17525030 AGTGTGAAGAAACTTGTGGAAGG - Intergenic
987406582 5:17528442-17528464 AGTGTGAAGAAACTTGTGGAAGG - Intergenic
987407114 5:17582529-17582551 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987407564 5:17585963-17585985 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987407815 5:17587728-17587750 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987408262 5:17591165-17591187 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987408710 5:17594599-17594621 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987409166 5:17598033-17598055 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987409281 5:17598764-17598786 AGTGTGAAGAAACTTGTGGAAGG + Intergenic
987412832 5:17631861-17631883 AGTGTGAAGAAACTTGTGGAAGG - Intergenic
987566410 5:19593660-19593682 AGGAGGAAGAAGGAGGTAGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988608779 5:32705546-32705568 AGGAGGAAGAGGGATGGGGAGGG + Intronic
988832934 5:35004822-35004844 GGTGGGAAGAAGGAAGTGGATGG - Intronic
988835534 5:35028771-35028793 AGTGCAGAGAAAGATGTGGAAGG + Intronic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
989534520 5:42548659-42548681 AGAGGGAAGAACGAAGTGGGAGG - Intronic
990347318 5:54883637-54883659 AGTGCTAAGAAGGATCAGGAGGG + Intergenic
991596270 5:68309878-68309900 AGCAGGAAGAAAGGTGTGGAGGG + Intergenic
992666377 5:79013466-79013488 AGAGGTTAGAAGGATGTGGAGGG - Intronic
992828392 5:80570718-80570740 AGTGGGTACAGGGATGCGGAGGG - Intergenic
992858117 5:80884807-80884829 AGTGGGAAGTAGCATGTGAGAGG - Intergenic
993482125 5:88437145-88437167 AGTGTGTAGAAGGATGTAGAAGG - Intergenic
993899857 5:93578097-93578119 CGTGGTAAGAAAGATATGGAGGG + Intergenic
994018347 5:94994805-94994827 AGCAGGCAGAAGAATGTGGAAGG + Intronic
994088365 5:95784751-95784773 AGTGGGAATAAGGATTTGGCAGG - Intronic
994570606 5:101508500-101508522 AAAGGGGAGAAGGAGGTGGAAGG - Intergenic
994800231 5:104364174-104364196 AGTGGTAGGAAGTTTGTGGAAGG + Intergenic
995034558 5:107518500-107518522 GGTGGGCAGAAGGATGTTCAAGG + Intronic
995123784 5:108560123-108560145 AGAGGGGAGAAGGAGGGGGAGGG + Intergenic
995167472 5:109061731-109061753 ACTGGGAATAAAGCTGTGGAGGG + Intronic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
995907262 5:117140780-117140802 ATTGGGAAAACGGAAGTGGAGGG + Intergenic
996387568 5:122925179-122925201 AGGGGGAAGAAGGATGGGAGGGG - Intronic
997663028 5:135603859-135603881 AGTGGGAGGTGGGAGGTGGAGGG + Intergenic
997696306 5:135863808-135863830 AGGAGGAAGGAGCATGTGGAGGG + Intronic
997883062 5:137607695-137607717 CATGGGAAGAAGGGTGTGTACGG + Intergenic
998475967 5:142422157-142422179 AGTGGGGAGACTGAGGTGGAAGG + Intergenic
999122382 5:149219210-149219232 AGTGGGAAGAAGCACGTGGTTGG - Intronic
999149502 5:149417363-149417385 AGGAGGAAGAAAGATGGGGAGGG - Intergenic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
1000106584 5:158065543-158065565 GGTGGGAGGAAGGAAGTGGGAGG + Intergenic
1000296963 5:159920579-159920601 TCAGGGAAGAAGGATGTTGATGG - Intronic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1001942356 5:175749826-175749848 AGTGAGAAGAAGGGAGTGCAGGG + Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002339667 5:178506534-178506556 GGTGGGAAGTAGGGTCTGGATGG + Intronic
1002494099 5:179600006-179600028 AGTGGAAGGGAGGAAGTGGAGGG + Intronic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1002684493 5:180997492-180997514 AGTGGGGAGAAGGAGGAGCAAGG + Intronic
1003442418 6:6155443-6155465 AGCAGGGAGAAGGATGGGGAGGG + Intronic
1003459225 6:6314566-6314588 AGTGGGGAAGAGGATGAGGAGGG - Intronic
1003578819 6:7321003-7321025 AGTGGGAGTAAGGATGGGAATGG + Intronic
1003595178 6:7468332-7468354 AACAGGAAGAAGGATGAGGATGG + Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1005089501 6:22042190-22042212 AGTGGGGAGAGGGATGAAGAAGG - Intergenic
1005172315 6:23002138-23002160 AGAGGACAGAAGGATGGGGATGG + Intergenic
1006312851 6:33273162-33273184 AGTGTGAAGAAGCCTGTAGATGG + Intronic
1006315107 6:33286736-33286758 GGTGGGCAGAAAGGTGTGGAAGG - Intronic
1006373765 6:33660448-33660470 GGAGGTAAGAAGGATGAGGAGGG - Intronic
1006480971 6:34293943-34293965 GGTGGGAAGAGGGGTGTGGGTGG - Intronic
1006480978 6:34293961-34293983 AGTGGGAAAAGGGGTGTGGGTGG - Intronic
1006563898 6:34937579-34937601 AGTGGGGAGAAAGGTGAGGAAGG + Intronic
1006860571 6:37169733-37169755 CGAGGGAGGAAGGATGGGGAGGG - Intergenic
1007117943 6:39356974-39356996 AGTGGGAAGAAGGGATTGGCAGG - Intronic
1007182185 6:39937406-39937428 AGGGTGGAGAAGGATCTGGAGGG - Intergenic
1007614759 6:43173293-43173315 CTTGGGAAGAAGGTTATGGAAGG - Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1008057187 6:46957028-46957050 AGTGGGAAGAAGCACATGAATGG + Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1008985538 6:57538121-57538143 ACTGGGAAGAATGAAGTGGGAGG - Intronic
1009529877 6:64798720-64798742 AGTGGGAAGAGAGTTATGGAAGG - Intronic
1010317511 6:74467980-74468002 AGTGGGGAGAAGGAAGGGCACGG + Intergenic
1010318832 6:74483192-74483214 AGAGGGAGGAAGGAGGTGAAAGG - Intergenic
1010376516 6:75176502-75176524 AGTGGGGAGAGTGATGTAGAGGG + Intronic
1010687343 6:78867972-78867994 AGCGGGAAGGGAGATGTGGAGGG + Intronic
1010899943 6:81414737-81414759 AGTAGGAAGTAGGATTTGGCAGG + Intergenic
1011180930 6:84619792-84619814 AGTTGGGAAAAGGATCTGGATGG - Intergenic
1011786319 6:90849228-90849250 AGTCAGAAGAAGGATGGAGAAGG + Intergenic
1013070406 6:106723963-106723985 AGAGGGGAGAAGGGTGGGGATGG + Intergenic
1013370967 6:109470657-109470679 AGTGGGAGGCAGGATGCTGAGGG - Intronic
1013545122 6:111149061-111149083 AGTGTGAAGAATGAAATGGAAGG - Intronic
1013658063 6:112265946-112265968 TGTGGGAAGATGGGTGTGGAAGG + Intergenic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014546285 6:122740271-122740293 AGTGGGAGGAAGCTTTTGGAGGG + Intergenic
1014857623 6:126421500-126421522 AGTTGGAGAATGGATGTGGAGGG - Intergenic
1015022709 6:128495669-128495691 AGTGTGAAAAAGGGTTTGGAGGG - Intronic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016859900 6:148707147-148707169 AGCAGGTAGAAGAATGTGGAAGG - Intergenic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017978520 6:159377981-159378003 GGTGGGAAGGAGGATGGGAAGGG + Intergenic
1018199330 6:161380624-161380646 AGTGGAAAGAAGGAAGAAGAAGG - Intronic
1018208322 6:161456256-161456278 AGCAGGCAGAAGGGTGTGGAAGG + Intronic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1019519476 7:1454266-1454288 AGTGGGGAGAGGCAGGTGGACGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019772411 7:2891835-2891857 AGGAGGAAGAAGGTTCTGGAAGG + Intergenic
1020080240 7:5282853-5282875 AGAGGGAAGAGGGAGGAGGAGGG + Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020129052 7:5549180-5549202 AGAGGGAAGAAGGAGAGGGAAGG + Intronic
1020143535 7:5625264-5625286 GCTGGGGAGAAGGATGGGGAGGG + Intronic
1020279811 7:6644372-6644394 GCTGGGAAGATGGAGGTGGAGGG + Intronic
1020434122 7:8143834-8143856 TGTGGGAAGAAAGATGCAGAGGG + Intronic
1020598398 7:10241580-10241602 AGTGGAGAGAGGGATGTGCATGG - Intergenic
1021128263 7:16880067-16880089 AGGGGAAAGAAGGAAGGGGAAGG - Intronic
1021656897 7:22881696-22881718 GGAGGGAAGAGGGATGTGGGGGG - Intergenic
1022491941 7:30827470-30827492 GGTGGTTAGAGGGATGTGGAAGG - Intronic
1022826523 7:34020013-34020035 AGAGGAAAGAAGGATTTGAAAGG + Intronic
1022942472 7:35253972-35253994 AGAGGGAGGAAGGACGCGGAGGG - Exonic
1022972425 7:35530197-35530219 AGTGGGAAGGGAGATCTGGATGG + Intergenic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023519896 7:41039615-41039637 AGTGGGAAGAGCGATGGAGAGGG + Intergenic
1023593781 7:41807270-41807292 AGTGTGGATGAGGATGTGGACGG - Intergenic
1023604310 7:41914724-41914746 AGAGGGAAGAAGGAGGTGGCTGG + Intergenic
1024873556 7:53994133-53994155 AGTGACAAAAAGGATTTGGAGGG + Intergenic
1025184595 7:56847652-56847674 GGTGGGAAGGGGGAGGTGGAGGG - Intergenic
1025222399 7:57125128-57125150 AATGGGAAGAAGCATTTGAAAGG + Intronic
1025687334 7:63729316-63729338 GGTGGGAAGGGGGAGGTGGAGGG + Intergenic
1025719233 7:63994875-63994897 AATGGGAAGAAGCATTTGAAAGG - Intergenic
1025742923 7:64214991-64215013 AATGGGAAGAAGTATTTGAAAGG - Intronic
1026044077 7:66893607-66893629 GGAGGGAAGGAGGAGGTGGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028047326 7:86139058-86139080 AATGGGGAGAAGGAGTTGGAAGG - Intergenic
1028404124 7:90457659-90457681 AGTGAGAAGAAGGAAGGGCAAGG + Intronic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1028696752 7:93722779-93722801 AGTAGGAAGAAAGATGTAGATGG - Intronic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029572497 7:101379471-101379493 AGAGGCAGGAAGGATCTGGAGGG - Intronic
1029696602 7:102217701-102217723 AGAGGGAGGGAGGATCTGGATGG + Intronic
1029696626 7:102217812-102217834 AGAGGGAGGGAGGATCTGGATGG + Intronic
1029696642 7:102217886-102217908 AGAGGGAGGGAGGATCTGGATGG + Intronic
1029956335 7:104644279-104644301 TATGGGAAAGAGGATGTGGAGGG - Intronic
1030368839 7:108674658-108674680 TTTGGGAAGAAGTATATGGATGG + Intergenic
1030960387 7:115913090-115913112 AATGGGAATAAGGGTGAGGATGG - Intergenic
1030979562 7:116170597-116170619 ATTGGGAAGAAGGGTGTTGGGGG + Intergenic
1030996798 7:116369240-116369262 AGCGGGAGGAAGGATGGAGAGGG - Intronic
1031185485 7:118474613-118474635 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032153014 7:129446330-129446352 TGGGGAAAGAAGTATGTGGATGG - Intronic
1032890603 7:136191112-136191134 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1033591153 7:142809386-142809408 AGTGGGAGGATACATGTGGAGGG - Intergenic
1033832604 7:145271580-145271602 AGAAGGAAGAAGGAGGAGGAGGG + Intergenic
1034211338 7:149365703-149365725 ATTGGGAAGGAGGATGTTGCAGG - Intergenic
1034447054 7:151119096-151119118 TGTGGGAAAAAGGAGGAGGAGGG + Intronic
1034704715 7:153130316-153130338 AGTGGGAAGATGGCTGGGGGTGG - Intergenic
1035080225 7:156209549-156209571 AGGCGGAAGAAGGAGGTGCAGGG - Intergenic
1035339580 7:158151648-158151670 AGAGGGAAGAAGGAGGGGGCGGG - Intronic
1036643818 8:10600060-10600082 AGAGGGGAGCAGGATGTGGGTGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037835459 8:22212601-22212623 GGAGGGAAGAAGGATGTGAAAGG + Intergenic
1039007544 8:33056737-33056759 AGTGGGAAGGAGGGTGGGAAGGG + Intergenic
1039385452 8:37131649-37131671 AGCAGGCAGAAGAATGTGGAAGG - Intergenic
1040565609 8:48564424-48564446 TGGTGGAAGAAGGATGTGGTGGG + Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1040917212 8:52574556-52574578 AGAGGGGAGAAGGAGGGGGAGGG + Intergenic
1041470986 8:58208846-58208868 AGTGAGAAGAGAGAGGTGGAGGG - Intergenic
1042001180 8:64124922-64124944 AGTTGGAAGGGGGATGTGGTGGG + Intergenic
1042052517 8:64726790-64726812 AGTGGCAAGAAGGAATGGGAAGG - Intronic
1042077779 8:65015295-65015317 AGTGGGCAGTAGGAAGTGGGGGG - Intergenic
1042484253 8:69333752-69333774 AGTGGGCAGAAGGAGGGGAAGGG + Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043128251 8:76427776-76427798 ATTAGGAAGCAGGGTGTGGAGGG - Intergenic
1043614025 8:82103372-82103394 AGTGGGCAGAAGAAAGTGGAAGG + Intergenic
1043855801 8:85263311-85263333 AGTGGGAAGAAGACAATGGAAGG + Intronic
1044388734 8:91623068-91623090 TGTAGGCAGAAGCATGTGGAGGG + Intergenic
1045074088 8:98543229-98543251 AGCTGGAAGAAGGATGAAGAGGG + Intronic
1045128847 8:99125354-99125376 AGCAGGCAGAAGAATGTGGAAGG - Intronic
1045475678 8:102550314-102550336 AGTGGGATGATGGGTGGGGAAGG + Intergenic
1046518129 8:115289514-115289536 AGCAGGGAGAAGAATGTGGAAGG - Intergenic
1047201766 8:122773190-122773212 AAGGGGTATAAGGATGTGGATGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048015218 8:130491101-130491123 AGTGGGAAGTTGAATGTGGAAGG + Intergenic
1048258685 8:132926229-132926251 AGTGGCAAGAGGGCTGAGGAAGG - Intronic
1048458893 8:134603308-134603330 AGAAGGAAGAAGGAAGAGGAAGG + Intronic
1048575750 8:135688714-135688736 AGTGGGAAGAGAGCTGGGGAAGG - Intergenic
1048607176 8:135981702-135981724 TGTGGGATGAAGGTTGGGGAGGG + Intergenic
1048946579 8:139454015-139454037 AGTGGGAAGCAGAATGTAGGTGG - Intergenic
1048968448 8:139630509-139630531 AGTGGGTGGAAGGGTGTGGGTGG - Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049315351 8:141964125-141964147 AGTGGGAAGGGGGATGTTTAGGG - Intergenic
1049705572 8:144040552-144040574 AGTGGGACTAGTGATGTGGAGGG - Exonic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1051073549 9:13202916-13202938 TATAGGAAGAAGGATGTGGGAGG + Intronic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1051942852 9:22529932-22529954 AGTGGGAAGAAATGTTTGGAAGG - Intergenic
1052955580 9:34251104-34251126 GGTGGGAAGATGGATGTGGGTGG + Intronic
1053062110 9:35040193-35040215 AGTCTGAAGAAGGAGGTTGATGG - Intergenic
1053202494 9:36162293-36162315 AGCCTGAAGAAGGATGTGGCAGG - Intronic
1053473704 9:38365735-38365757 GATGGGGAGAAGGATGTCGATGG - Intergenic
1054713838 9:68537863-68537885 AAAGGGAGCAAGGATGTGGATGG - Intronic
1054735743 9:68748308-68748330 AGTGGAGAGAAGGATATGGTGGG - Intronic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055354915 9:75427970-75427992 TGTGGGAAGAAGGATAAGTAGGG + Intergenic
1055379382 9:75689498-75689520 AGTGGGAGGAAGAATAAGGAGGG + Intergenic
1056497287 9:87170723-87170745 AGTTGGAAAAAGGAGGTGGTTGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056765577 9:89442787-89442809 AATGGTGAGAAGGATGGGGAGGG - Intronic
1057085073 9:92202534-92202556 TGTTGGAAGAGGGATGTGGTGGG + Intergenic
1057398171 9:94698973-94698995 AATTGGAAGAAGAATGTGAAGGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058146618 9:101419139-101419161 AGAGGGAAGAAGGAAGGGAATGG - Intergenic
1059354226 9:113687062-113687084 GGAGGGAAGAAGGAGGAGGAAGG + Intergenic
1059529705 9:115024344-115024366 GGTGGGAAGAGGGCTGTGGCTGG + Intronic
1059644656 9:116252535-116252557 AGAGGGAAGATGGGTGTGGTGGG + Intronic
1060028925 9:120197527-120197549 AATGGGAAGAGGGAAGTGGCTGG - Intergenic
1061238830 9:129357667-129357689 AGTGGGGAGACGGAGGGGGAAGG - Intergenic
1061578393 9:131522167-131522189 AGGGAGCAGAAGGATTTGGAAGG - Exonic
1062051955 9:134452030-134452052 GGTGGGTAGGTGGATGTGGATGG - Intergenic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062662702 9:137647105-137647127 ACTGGGAAGAAGGAGGCGGCAGG - Intronic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186265689 X:7831038-7831060 AGAGGGAAGAAGGCTGGGCATGG + Intergenic
1186952708 X:14645016-14645038 AATGTGAAGAAGAATTTGGATGG + Intronic
1187241140 X:17514329-17514351 AGCAGGCAGAAGAATGTGGAAGG + Intronic
1188172437 X:26943910-26943932 AGTGGAAAGTAGGAGGAGGAGGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1190053499 X:47169288-47169310 TGGAGGAAGAAGGATGGGGAGGG - Intronic
1190060961 X:47211407-47211429 AGTGGGAAGGAGGAGGAGGGAGG - Intronic
1190334082 X:49252134-49252156 AGTGGGGTCAAGGATTTGGAAGG + Intronic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192473407 X:71419318-71419340 AGTGGGAACAGGGAGGTGGGAGG - Intronic
1192779435 X:74278899-74278921 AGAGTGAAGAAGGATATGTAGGG + Intergenic
1192903420 X:75523584-75523606 AGTGGGAGGATGGAGCTGGATGG - Intergenic
1193391573 X:80935429-80935451 AGTAGGCAGAAGAATGTGGAAGG + Intergenic
1193915317 X:87355858-87355880 AGTAGGCAGAAGAATGTGGAAGG - Intergenic
1194343394 X:92731712-92731734 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194613798 X:96076352-96076374 ACTGGGAAGACTGATGGGGAAGG - Intergenic
1194834036 X:98659426-98659448 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194910718 X:99640862-99640884 AGTGCAAAGAAGGATGGGAAAGG + Intergenic
1194978656 X:100417640-100417662 GGTGGGAAGGAGGTTATGGAGGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195974634 X:110513130-110513152 AATAGGAAGAAGCATGTGGTGGG - Intergenic
1196355768 X:114790320-114790342 AGTAGGAGTAAGGATTTGGAAGG - Intronic
1196592481 X:117503183-117503205 ACTGGAAAGAAGGAGGTGGTTGG + Intergenic
1196978075 X:121181924-121181946 AGCTGGAAGAAGGAAGTGGTGGG + Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197978139 X:132187154-132187176 AGTGCGGAGAAGGATTTGGAGGG - Intergenic
1198132772 X:133715133-133715155 AGCAGGCAGAAGAATGTGGAAGG + Intronic
1198402548 X:136281727-136281749 AGTGGGAACAGGGAAGTGGGAGG - Intergenic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1199116492 X:143998633-143998655 TTTGGGAAGAAGTATGTGGATGG - Intergenic
1199642819 X:149880953-149880975 AGTGGGGGGAAGGGTGTGGTGGG - Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1200651748 Y:5848377-5848399 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic