ID: 921491105

View in Genome Browser
Species Human (GRCh38)
Location 1:215776984-215777006
Sequence TGCCCAATACAGCCCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921491105 Original CRISPR TGCCCAATACAGCCCTAAAG AGG (reversed) Intronic
903370950 1:22835833-22835855 TGCCCAGGACAGCCCTGATGGGG + Intronic
904176907 1:28636421-28636443 TGCTCAATACAGCTGAAAAGTGG - Intronic
906709107 1:47916052-47916074 CGCCGCAGACAGCCCTAAAGGGG + Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
910152839 1:84173528-84173550 TACCAAATAAAGCTCTAAAGAGG + Intronic
912431005 1:109628399-109628421 TGCCAAATACAACCCTATTGGGG + Exonic
913971311 1:143420321-143420343 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
914065688 1:144245934-144245956 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
914113463 1:144720420-144720442 TTCCCAATGCAGCCCTAGAGTGG - Intergenic
920046438 1:203135912-203135934 TGCCCAACCCAGCCCAGAAGGGG - Intronic
921491105 1:215776984-215777006 TGCCCAATACAGCCCTAAAGAGG - Intronic
924840765 1:247707690-247707712 TGACCCATCCAGCCATAAAGTGG - Intergenic
924847120 1:247784995-247785017 TGACCCATCCAGCCATAAAGTGG - Intergenic
1072360480 10:94654289-94654311 TGACCAATCTAGCCTTAAAGTGG + Intergenic
1072574949 10:96690878-96690900 TTCCAACTCCAGCCCTAAAGAGG - Intronic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1084423959 11:69074285-69074307 TGAGGAATGCAGCCCTAAAGAGG - Intronic
1085378126 11:76086275-76086297 TGCTCACTCCTGCCCTAAAGTGG + Intronic
1086834130 11:91600508-91600530 TGACCCATATAGCCATAAAGGGG + Intergenic
1092743684 12:11653728-11653750 GGCCCACTACAGCCTTAGAGAGG + Intronic
1095259608 12:40083169-40083191 TGCACAATTCAGACCCAAAGGGG - Intronic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1107761115 13:43680020-43680042 AGGCAAATACAACCCTAAAGGGG + Intronic
1108914291 13:55588755-55588777 TGACCTATCCAGCCATAAAGTGG - Intergenic
1109519034 13:63484918-63484940 TGTCCCATCCAGCCATAAAGTGG + Intergenic
1109918736 13:69027312-69027334 TGCCCAAAGAAGTCCTAAAGTGG + Intergenic
1112000345 13:95203915-95203937 GGCCCAATACAGACCCAAGGTGG - Intronic
1124382923 15:29182723-29182745 TGGCCAAGACAGTTCTAAAGAGG + Intronic
1129972073 15:79787530-79787552 TTCCCCATAGAGCCCAAAAGAGG - Intergenic
1133013352 16:2927080-2927102 GGTCCAATACAGACCTCAAGTGG + Intronic
1135867239 16:26114866-26114888 TCCCTAATATAGCCATAAAGAGG - Intronic
1140786406 16:78346471-78346493 TGGCAAATACTTCCCTAAAGTGG + Intronic
1141900233 16:86986236-86986258 TGCCCTTTCCAGCCCTGAAGAGG + Intergenic
1147847868 17:43417882-43417904 TGCCCCAGGCAGCCCCAAAGAGG - Intergenic
1148139857 17:45320542-45320564 TGCACAAGACAGCCCTGATGTGG - Intergenic
926225922 2:10966811-10966833 TGCCCAATACAGCTCTGCTGAGG - Intergenic
926542102 2:14193747-14193769 TGCCCAATATGGCCCTACACGGG - Intergenic
932886814 2:75556193-75556215 TGCCCTTTACAGCACTAAACAGG + Intronic
934176006 2:89581254-89581276 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
934286316 2:91655616-91655638 TTCCCAATGCAGCCCTAGAGTGG + Intergenic
936261853 2:110966563-110966585 TGCCCCCTAAACCCCTAAAGGGG + Intronic
947186029 2:227456458-227456480 TGCCCTAAAAGGCCCTAAAGGGG - Intergenic
948769848 2:240246033-240246055 GGCGCAATGCAGCCCTAGAGGGG + Intergenic
1173744382 20:45425492-45425514 TGCCCAATACTGCCGGAATGAGG + Intronic
1175352827 20:58337603-58337625 AGCCCATCACAGCCCTCAAGTGG - Intronic
1179116962 21:38502174-38502196 TGCCCTATACATCCCTACAATGG + Intronic
1181977117 22:26737936-26737958 TGACCAATCAAGCCCTAATGAGG - Intergenic
1182876296 22:33694022-33694044 GGCCCAATACAGTCCTGAGGTGG + Intronic
1183808624 22:40235225-40235247 TGCCCAATACAGATTTAAATAGG - Intronic
1185169103 22:49282021-49282043 TGCCCAAAAGACCCCTAAGGAGG + Intergenic
955023490 3:55144295-55144317 TGCCTAATCCAGTCCTATAGTGG - Intergenic
955863202 3:63354376-63354398 TTGCCCACACAGCCCTAAAGTGG - Intronic
956306888 3:67835736-67835758 TGACCCATCCAGCCATAAAGTGG + Intergenic
972882949 4:43448040-43448062 TGACCAATCTAGCCATAAAGTGG - Intergenic
974061181 4:57037609-57037631 TGCCCTGTACAGTCCTAAAAGGG + Intronic
975957069 4:79853927-79853949 TGGATCATACAGCCCTAAAGGGG - Intergenic
977357082 4:95960010-95960032 TGCCCATTGCAGCCCCAAAGAGG - Intergenic
978492005 4:109319447-109319469 CGCCCAATCCAGGCCTAGAGAGG - Intergenic
978554819 4:109968978-109969000 TTGCCCATACAGCCCTGAAGTGG + Exonic
980385778 4:132086917-132086939 TGACCCATATAGCCATAAAGTGG - Intergenic
983062324 4:163173930-163173952 TGCCCAATATGGCCATCAAGAGG - Intergenic
984607707 4:181804387-181804409 TGCTCTATCCAGCCCTAAAGGGG + Intergenic
991605073 5:68392949-68392971 TGCCCAGTGCAACCCTAAATAGG - Intergenic
993714649 5:91263855-91263877 TACTCAAAATAGCCCTAAAGTGG + Intergenic
995776277 5:115727584-115727606 TGACCCATCCAGCCATAAAGTGG - Intergenic
999458953 5:151741150-151741172 TGCCCAATAAATGGCTAAAGTGG + Intergenic
1000416983 5:160994017-160994039 TGACCCATCCAGCCATAAAGTGG + Intergenic
1005664287 6:28034942-28034964 TACCCAATACAAACCTACAGAGG + Intergenic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1008544677 6:52574637-52574659 TCCCCAATACAAGCCTAAGGGGG + Intronic
1008584135 6:52933698-52933720 CACCCAAAACAGCCTTAAAGAGG + Intergenic
1009310911 6:62151462-62151484 TGCCCTATTCATCACTAAAGAGG - Intronic
1009806507 6:68607060-68607082 TGACCAATGTAGCCATAAAGTGG + Intergenic
1013805528 6:113992166-113992188 TGCCCATTACATCCCTCTAGAGG + Intronic
1016451172 6:144184067-144184089 TGTACTATACAGCCATAAAGAGG - Intronic
1021665014 7:22968582-22968604 TACCCAATATGGCCCTATAGGGG + Intronic
1029549839 7:101231972-101231994 TGTACAACACAGCCCCAAAGTGG + Intergenic
1031676569 7:124618487-124618509 TGACCCATACAGCCATAAATTGG + Intergenic
1034301140 7:150016434-150016456 TTCCCATTAGAGCCCTAATGAGG + Intergenic
1041715351 8:60927121-60927143 TGACCAATACAGCTTTAAACAGG - Intergenic
1042501531 8:69514584-69514606 TTCCCAATAGCCCCCTAAAGTGG + Intronic
1045109542 8:98927133-98927155 GGCCTAATGTAGCCCTAAAGTGG - Intronic
1050305564 9:4302115-4302137 TGACCAATTCAGCCCAGAAGAGG - Intronic
1053402306 9:37836039-37836061 TGTCCAATACAGCCTTACCGTGG - Intronic
1060685651 9:125608970-125608992 TTTCCAATACTGCCCTACAGTGG + Intronic
1062608197 9:137358206-137358228 TGCCCAACACTGCCCTGCAGAGG + Intronic
1186171881 X:6885506-6885528 TACCCAATACAAACCTTAAGGGG + Intergenic
1187200735 X:17131458-17131480 TGCCCACTTCATCCCTAACGTGG - Intronic
1193297796 X:79852786-79852808 TGACCAATCTAGCCATAAAGTGG + Intergenic
1194123578 X:89988630-89988652 TTCCCAATATAGGCCTAGAGAGG + Intergenic
1200476463 Y:3646251-3646273 TTCCCAATATAGGCCTAGAGAGG + Intergenic