ID: 921492155

View in Genome Browser
Species Human (GRCh38)
Location 1:215790449-215790471
Sequence GTCTAGTGCTCTTGGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921492155_921492159 30 Left 921492155 1:215790449-215790471 CCTTCTTACCAAGAGCACTAGAC 0: 1
1: 0
2: 1
3: 3
4: 88
Right 921492159 1:215790502-215790524 ATGTTCGAAAATCATTCAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 86
921492155_921492158 5 Left 921492155 1:215790449-215790471 CCTTCTTACCAAGAGCACTAGAC 0: 1
1: 0
2: 1
3: 3
4: 88
Right 921492158 1:215790477-215790499 TTAGGAAAAGAACACACAAGAGG 0: 1
1: 1
2: 4
3: 42
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921492155 Original CRISPR GTCTAGTGCTCTTGGTAAGA AGG (reversed) Intronic
900490885 1:2948603-2948625 TTGTGGTGCTCTTGGGAAGAGGG + Intergenic
906847212 1:49206150-49206172 GTCTAGAACTGTTGGGAAGAGGG + Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
911689506 1:100816585-100816607 GTATAGTGCTTTTGGCAATATGG - Intergenic
918000935 1:180494958-180494980 TTATAGTACTCTTGGGAAGAAGG - Intronic
921492155 1:215790449-215790471 GTCTAGTGCTCTTGGTAAGAAGG - Intronic
1064356745 10:14625722-14625744 GTCCAGTGCTATTGCTTAGAAGG + Intronic
1073914430 10:108385815-108385837 GTCTAGTTCTTTTGCCAAGATGG - Intergenic
1073960932 10:108926843-108926865 GTCTAATGCTATTGTTAGGATGG - Intergenic
1074464459 10:113669165-113669187 GTCTGATGCTCTTGGGGAGAGGG + Intergenic
1078690667 11:13577227-13577249 GTATATTGCTCTTGGCCAGAGGG - Intergenic
1084914589 11:72418957-72418979 GCCTAGGGCTCTTGCTCAGAAGG + Intronic
1094649005 12:32356958-32356980 CTATAGTGCTTTTGCTAAGAAGG + Intronic
1098361470 12:69658414-69658436 GTCTGGTGCTCTTGCTATGTTGG + Intronic
1099850459 12:88089397-88089419 GGCTACTGCTCTTGGTAAGTTGG - Exonic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1114007315 14:18329130-18329152 GTCTATTGGATTTGGTAAGAGGG - Intergenic
1116373521 14:44167799-44167821 GTCTAGTGCTCTTGGTTTATTGG - Intergenic
1123391236 15:19875792-19875814 GTCTATTGGATTTGGTAAGAGGG - Intergenic
1123800074 15:23810288-23810310 TTCTTATGCTCTTGGGAAGATGG + Intergenic
1131297141 15:91159068-91159090 TTCTAGTGCTCTTGATGAAAAGG - Intronic
1136186410 16:28591214-28591236 GCCTTGTGCTCTTGGTGACATGG + Intronic
1139628936 16:68215510-68215532 CACTAATGATCTTGGTAAGAAGG + Intronic
1139812400 16:69632849-69632871 GTCTAGTTTTCTTGGAAAAAAGG - Intronic
1151172113 17:72255526-72255548 GTCTAATACTCTTCTTAAGATGG - Intergenic
1151210396 17:72540107-72540129 GTCAGGAGCTATTGGTAAGACGG + Intergenic
1151577379 17:74959557-74959579 GTCTTGTGATCTTGGTGGGAAGG - Intronic
1153547492 18:6223628-6223650 GGCTTTTCCTCTTGGTAAGAAGG + Intronic
1154530157 18:15334833-15334855 GTCTATTGGATTTGGTAAGAGGG + Intergenic
1157070460 18:44401665-44401687 TTCTAGAGCTCCTGGAAAGATGG + Intergenic
1157126071 18:44957428-44957450 GTTTAGTGCCATTGTTAAGAAGG + Intronic
1161614310 19:5261404-5261426 CTCTTTTCCTCTTGGTAAGAAGG - Intronic
1164898355 19:31897028-31897050 GTCGAGTTCTCTGGGAAAGAGGG + Intergenic
1168607954 19:57774931-57774953 GTCTAGTCCTCTTGATTAAAAGG - Intronic
927805342 2:26141962-26141984 GCATGGTGCTCTTGGTCAGAAGG - Intergenic
929265166 2:39910599-39910621 GTCTAGAGCTATTTCTAAGAAGG - Intergenic
930127358 2:47812060-47812082 CTCAAGTGCTATTGCTAAGATGG + Intronic
935889881 2:107664834-107664856 GTCAAGTGCTCTGGGTAATGTGG - Intergenic
937994505 2:127682552-127682574 GTCTTGTGCTATTTGGAAGAAGG + Intergenic
938529254 2:132166268-132166290 GTCTATTGGATTTGGTAAGAGGG + Intronic
938790008 2:134668297-134668319 GTCTAGTGACCTTGGAGAGAGGG - Intronic
939341625 2:140902961-140902983 GTCAAGTGCTCATGTTATGAAGG - Exonic
945116960 2:206417362-206417384 GTCCAGTGGGCTTGGGAAGAGGG - Intergenic
948351511 2:237344806-237344828 GGCTAGTTCTGTTGGGAAGACGG + Exonic
1172163552 20:32885055-32885077 CTCTAGTGCTCTGGGGTAGAGGG - Intronic
1176662230 21:9647974-9647996 GTCTAAACCTCTTGGAAAGATGG - Intergenic
1176767254 21:13033634-13033656 GTCTATTGGATTTGGTAAGAGGG - Intergenic
1177646140 21:23901886-23901908 ATCTAGTGATCTTGGGAAGAGGG + Intergenic
1180431822 22:15259937-15259959 GTCTATTGGATTTGGTAAGAGGG - Intergenic
1180885517 22:19240623-19240645 GGCTAGGCCTATTGGTAAGAAGG + Intronic
1182199140 22:28552297-28552319 GTAGATTGCTCTTGGCAAGATGG - Intronic
962442255 3:135431836-135431858 GTTTAGTGCTGTAAGTAAGATGG - Intergenic
964895024 3:161585593-161585615 GTCTATTCCACTTAGTAAGAAGG + Intergenic
965348961 3:167589512-167589534 GTATATTGCTTTTGGTAATATGG + Intronic
967997934 3:195180606-195180628 GTCTGGTGCTCTTAGCCAGACGG - Intronic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
970095473 4:12459154-12459176 CTCCAGTGCTCCTGGTAAGTTGG + Intergenic
974328339 4:60444323-60444345 GTCTAGTGCTGAAGGTAAAATGG + Intergenic
986740456 5:10700834-10700856 GTCACGTGCTATAGGTAAGATGG + Intronic
989106541 5:37868236-37868258 CTCAAGTGCTCTTTGGAAGAAGG + Intergenic
993119785 5:83760566-83760588 GGCTGGTGCTATTGGTCAGAGGG + Intergenic
993660768 5:90631490-90631512 GTGTAGGGCTCTGGGGAAGATGG - Intronic
994093749 5:95830453-95830475 GGCTTGTGCTGTTGGGAAGAAGG + Intergenic
995161351 5:108987020-108987042 GTAGATTGCTCTTGGTAATATGG + Intronic
995628676 5:114109379-114109401 GCCTTATGCTCTTGGTTAGAAGG + Intergenic
1004307225 6:14512063-14512085 GTCTACTGCCCTGGGGAAGAAGG + Intergenic
1004474335 6:15957095-15957117 GTCTATTCCTCATGTTAAGAAGG - Intergenic
1007219402 6:40266611-40266633 GTCTGGTGCTGTTGGTCAGGAGG - Intergenic
1007984490 6:46194188-46194210 GTCTAGTGTTTTTGGAAAGTTGG + Intergenic
1009509932 6:64538153-64538175 GGCTGGTGCTCATGGTAATACGG + Intronic
1009831032 6:68935307-68935329 AACTAGTGCTCTAGGGAAGAAGG - Intronic
1010443412 6:75925482-75925504 TCCTAGTGCTCATGGGAAGAAGG + Intronic
1010840607 6:80645551-80645573 GTATATTGCTTTTGGTAGGATGG - Intergenic
1012364941 6:98427431-98427453 GCCTAGTGTTGTTGGTGAGATGG - Intergenic
1015060047 6:128952317-128952339 GTCTAGTGCTTGTGGTAATCTGG + Intronic
1015386960 6:132635314-132635336 GTCAAGTGGTCTTGCTCAGAGGG + Intergenic
1015555554 6:134458140-134458162 GACTAGTGCTCTTGCAAAAAAGG - Intergenic
1024620183 7:51150266-51150288 GTCTACTGCTCTTACTCAGAAGG + Intronic
1028418340 7:90604564-90604586 GTCTGGAGCTGTTGGTAAGTTGG + Intronic
1032367697 7:131315587-131315609 GTCAAGTGGTCTTGCTAAGTGGG + Intronic
1037470278 8:19201852-19201874 CTCTAATGCTCTCGGGAAGAGGG + Intergenic
1048428520 8:134344820-134344842 GACCTGTGCTCTGGGTAAGAGGG + Intergenic
1051681432 9:19611545-19611567 GGCTTTTGCTCTTGGTGAGATGG + Intronic
1055353003 9:75408590-75408612 TTCTAGTGCTCCTGGTGAAATGG + Intergenic
1056846668 9:90044180-90044202 GTCATGTGCTCTGGGTCAGAAGG - Intergenic
1058126130 9:101197141-101197163 GGCTAGTTCTCTGGGTAACAAGG - Intronic
1061293867 9:129666734-129666756 GTCCTGAGCCCTTGGTAAGAAGG + Intronic
1188925524 X:36038015-36038037 GTCTAGTGTTCTTGGAAAAAGGG - Intronic
1189388141 X:40554344-40554366 GTTAAGTACTCTTGGAAAGAAGG + Intergenic
1191202126 X:57794812-57794834 GTCTAGTGCTCCTGGTAAGGAGG + Intergenic
1191897330 X:66007132-66007154 GTCAAGTGGTCTAGGTAACAAGG - Intergenic
1195939133 X:110152913-110152935 GTCTTGTGCACTGGGGAAGATGG - Intronic
1201535743 Y:15046276-15046298 GAATAGTGATCTTGGCAAGAGGG - Intergenic