ID: 921497736

View in Genome Browser
Species Human (GRCh38)
Location 1:215861639-215861661
Sequence GGGTATTAACCAGAAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921497736_921497739 30 Left 921497736 1:215861639-215861661 CCAGTGTTTTCTGGTTAATACCC 0: 1
1: 0
2: 2
3: 7
4: 153
Right 921497739 1:215861692-215861714 TTGACACAAACACATACTACTGG 0: 1
1: 0
2: 1
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921497736 Original CRISPR GGGTATTAACCAGAAAACAC TGG (reversed) Intronic
919053804 1:192543708-192543730 AGGTATTAGCCAGAACAAACAGG - Intergenic
921497736 1:215861639-215861661 GGGTATTAACCAGAAAACACTGG - Intronic
1064683747 10:17837449-17837471 GGGAATAATCCAGAAAACAGTGG + Intronic
1065508751 10:26456545-26456567 GGGTTTTAAGAAGAAAACTCTGG + Intronic
1065583384 10:27193948-27193970 GGGTATTAAAAACAAAACCCAGG + Intergenic
1067364181 10:45609816-45609838 GGGTGTTAACAAGAGAAAACAGG + Intergenic
1068623989 10:59219866-59219888 TGGTATTAAACACAAAATACAGG + Intronic
1069864411 10:71492703-71492725 GGGTATACAGCAGAGAACACAGG + Intronic
1070949670 10:80420617-80420639 GGATATAGACCTGAAAACACTGG + Exonic
1074615919 10:115068002-115068024 GGGGCTTGACTAGAAAACACTGG + Intergenic
1075434144 10:122420024-122420046 GGGTAAAATCCAGAAGACACCGG + Intronic
1078156273 11:8802669-8802691 GGGGATTGCTCAGAAAACACTGG + Intronic
1079901802 11:26196127-26196149 AGGAATTAACTAGAAAACTCAGG - Intergenic
1081418708 11:42846323-42846345 GGGCAGTACCCAGAAACCACAGG - Intergenic
1083950427 11:65952354-65952376 GGCTATGACCCAGAAAGCACAGG - Intronic
1086470479 11:87103971-87103993 GGGTATGAACCCAAAAGCACAGG - Intronic
1087091034 11:94273429-94273451 GGGTATTGGCCAGGAACCACAGG - Intergenic
1087274512 11:96147668-96147690 GGGTTTTAGCCAGAAATCAATGG - Intronic
1093882042 12:24415916-24415938 GGGGCTTAACAACAAAACACAGG + Intergenic
1099711566 12:86232463-86232485 GGGTTTAAACCAAAACACACTGG - Intronic
1100127430 12:91445444-91445466 GGATATGACCCAAAAAACACAGG + Intergenic
1101023545 12:100577986-100578008 GGGCTTTATCCTGAAAACACTGG + Intronic
1101679754 12:106954236-106954258 GTGTAATAACGAGAAAACAGAGG + Intergenic
1102600370 12:114025192-114025214 AGGAATTAAACAGAAAACCCAGG + Intergenic
1104156478 12:126137777-126137799 GTGTAGTAACCAGATAACAGTGG + Intergenic
1108576982 13:51799274-51799296 TGTTCTTAATCAGAAAACACTGG + Intronic
1109087071 13:57987179-57987201 GGTTAATATCCAGAATACACAGG + Intergenic
1110520604 13:76471788-76471810 GGGTTTTATCCAGGAAAAACAGG - Intergenic
1111366624 13:87255159-87255181 GGATATTACCCTGAAAGCACAGG + Intergenic
1113490151 13:110685141-110685163 GAGTTTGCACCAGAAAACACAGG - Intronic
1114682783 14:24500814-24500836 GGATATTATCCCAAAAACACAGG - Intergenic
1114826868 14:26091373-26091395 GGCTAATAACCAGAATACACAGG + Intergenic
1117463431 14:55969347-55969369 GGATATTAATGAGAAGACACTGG + Intergenic
1118170926 14:63387802-63387824 GGGTCCTAACCAGATAATACAGG + Intronic
1119324875 14:73753879-73753901 GGGTATTTCCCAGATAATACCGG + Intronic
1121110008 14:91306210-91306232 GGGTGTTCAACAGAAAACAAAGG - Intronic
1123798119 15:23794174-23794196 GGGGATTGACCAGCAAACATGGG + Intergenic
1124988266 15:34644779-34644801 GGGTATTAACATGATAAAACTGG - Intergenic
1125733877 15:41910161-41910183 GGCAATTAACCAGAATACCCAGG + Intronic
1126252419 15:46584455-46584477 GGGTATCAAACAGAAGACAAAGG + Intergenic
1126358337 15:47819622-47819644 TGGCATTAACTAGAGAACACTGG - Intergenic
1130618186 15:85433548-85433570 GGGTTTAAACCAAAAAACAAAGG - Intronic
1131493954 15:92887838-92887860 GGTTCTTAAGCAGAAAACAGTGG - Intronic
1137979703 16:53059148-53059170 GGGTATTGATCAGAAATCTCAGG + Intronic
1138995009 16:62440019-62440041 GGTTAATATCCAGAATACACAGG + Intergenic
1140575411 16:76162235-76162257 GGCTACTAAACAGAAATCACTGG + Intergenic
1141000939 16:80307355-80307377 GCCTATGAACCAGAAAATACGGG - Intergenic
1146248367 17:31312154-31312176 GGGAATTAGCTGGAAAACACAGG + Intronic
1148954004 17:51338311-51338333 GAGGATTAAACAAAAAACACTGG + Intergenic
1156985004 18:43340885-43340907 GTGTATTATGCAGAAGACACTGG + Intergenic
1157606161 18:48927197-48927219 GCGAGTTAATCAGAAAACACTGG + Intronic
1159573992 18:70153669-70153691 GGAGATTTACCAGAAGACACTGG + Intronic
1160023562 18:75200586-75200608 GGGGGTTCACCACAAAACACGGG - Exonic
1160623933 18:80190171-80190193 CGATATTAAGCAGAAAACATGGG - Intronic
1163781502 19:19251766-19251788 GGTTATTATTCAGAAAACCCAGG + Exonic
1167533123 19:50031362-50031384 GGGTAGAAGCCAGAACACACAGG - Intronic
925500647 2:4500628-4500650 GGAGATTAATCTGAAAACACAGG - Intergenic
925551080 2:5075107-5075129 GAGAATTAGGCAGAAAACACAGG + Intergenic
928354241 2:30595125-30595147 GGGTATGAACCAGACAACACAGG - Intronic
929423091 2:41815208-41815230 GGTGGTTAACCAGAAAACAGAGG + Intergenic
930950944 2:57144358-57144380 GGATATTATCCTGAAAACAGAGG + Intergenic
933057379 2:77688761-77688783 AGTTATGAACCAGAAAACAGTGG - Intergenic
933927519 2:87109951-87109973 AGTTATGAACCAGAAAACAGTGG - Intergenic
935250912 2:101259733-101259755 GGGTATTAACAATATAACAATGG + Intronic
935820484 2:106887665-106887687 GAGTATTTACCAGCAAACAAAGG - Intergenic
936057081 2:109269367-109269389 GTGTAATTTCCAGAAAACACTGG + Intronic
936696586 2:114957041-114957063 GGATATTAGCAAAAAAACACAGG + Intronic
938560519 2:132468638-132468660 GGGTTTTAAACAGAAAACAGAGG + Intronic
939419934 2:141953655-141953677 GGGTATTAACCAAGGAAGACTGG + Intronic
944952334 2:204766183-204766205 GGGTATTGACCAGATAAAGCAGG - Intronic
945751991 2:213798684-213798706 GGTTATAAAACAGAAAACATTGG - Intronic
947141561 2:227023706-227023728 GGGTATGAACAAGAACACTCAGG + Intronic
948799966 2:240428787-240428809 GGATATGAAACAAAAAACACAGG - Intergenic
1169003534 20:2187027-2187049 AGGTTATAACCAGAAAAAACAGG - Intergenic
1169122262 20:3104110-3104132 GGGTATTAACCATTTAATACAGG + Intergenic
1169996859 20:11567539-11567561 GAGTAATAACCCCAAAACACAGG - Intergenic
1171080592 20:22179137-22179159 GGGCATTTACAAAAAAACACAGG + Intergenic
1172576774 20:36015403-36015425 GGGTATGACCCCAAAAACACAGG - Intronic
1177686860 21:24448137-24448159 AGGTGTTAACCAGAAATCTCTGG - Intergenic
1179927852 21:44548027-44548049 AGGTATCAGCCAGAAAACATTGG - Intronic
1182288953 22:29264422-29264444 TGGTATTAAACAGAATACACTGG + Intronic
949418126 3:3834985-3835007 GGGTATTAACCATCATACCCAGG + Intronic
949693840 3:6670964-6670986 AGAAATTAACCAGAAAATACAGG + Intergenic
950602030 3:14043386-14043408 GGGTACTCACCCAAAAACACAGG - Intronic
954422459 3:50425873-50425895 GGGTATTAAAAAGGAAACTCGGG + Intronic
958842394 3:99223238-99223260 GAGTAATACCCTGAAAACACAGG + Intergenic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
960824843 3:121771735-121771757 GGCCATTAAATAGAAAACACTGG + Intronic
961920847 3:130424529-130424551 GGGTCTCCACCACAAAACACAGG - Intronic
962154112 3:132926379-132926401 GGCTATAAACCAGTAATCACCGG + Intergenic
962863520 3:139426468-139426490 GTGAAGTAGCCAGAAAACACTGG - Intergenic
963245020 3:143049943-143049965 GTGTATTAGCCAGAAATCTCTGG + Intronic
964306398 3:155345334-155345356 GGGTATTAACCATAAAAAGAAGG - Intergenic
965945502 3:174235517-174235539 GGGTATTAAAAGGAAATCACTGG - Intronic
967155431 3:186687381-186687403 GGGTCCTATCCAGGAAACACTGG + Intergenic
969133046 4:5005894-5005916 GAGTATTACCCAAAAAGCACAGG + Intergenic
971535258 4:27739565-27739587 GGTTACTCACCAGAAACCACAGG - Intergenic
974843915 4:67328363-67328385 TGGTGTTAACCAGAATCCACTGG - Intergenic
977868509 4:102060401-102060423 GGGAATGTCCCAGAAAACACTGG - Intronic
981740722 4:147999129-147999151 GGGCATTGACCTGTAAACACGGG + Intronic
981868685 4:149460087-149460109 GGCTACTATCCAAAAAACACAGG - Intergenic
984123844 4:175780702-175780724 AGGTATTATTCAGAAAACACTGG - Intronic
984943599 4:184954502-184954524 CGGCCTTAACGAGAAAACACAGG + Intergenic
985812481 5:2099808-2099830 GGGTTTTAACTTGAAAACAAAGG + Intergenic
988716887 5:33837051-33837073 GGCTTTTAACCAGAGAACAATGG + Intronic
992140458 5:73791460-73791482 GGTTGTTAACAAGACAACACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994669263 5:102747014-102747036 GAGTATTAAAGGGAAAACACTGG - Intergenic
995131561 5:108636053-108636075 GGGTTTTAGCCAGAAAAAGCAGG - Intergenic
995901322 5:117070706-117070728 GGATATGATCCTGAAAACACAGG - Intergenic
996665519 5:126055473-126055495 GGGTATTACTAAGAACACACAGG + Intergenic
996848225 5:127924351-127924373 TGGTTAGAACCAGAAAACACTGG + Intergenic
996873200 5:128215046-128215068 GAGTCTTTACGAGAAAACACAGG + Intergenic
998414384 5:141935510-141935532 GTGTATTGGCCAGAAAACAAAGG - Intronic
998976283 5:147652469-147652491 GGGTATAAACCAGAATTCTCTGG + Intronic
999072954 5:148767054-148767076 TGGTATGAACCTGAAAACACTGG - Intergenic
999106945 5:149080884-149080906 GAAAATTAACCAGAAAATACTGG + Intergenic
1000448264 5:161351654-161351676 AGCTATTACCCAGAAAGCACAGG + Intronic
1002960400 6:1909032-1909054 GGGTATCCACCAGAAAACGCAGG + Intronic
1003744923 6:8989943-8989965 AGGTATTAAACAGACTACACTGG - Intergenic
1004349609 6:14879679-14879701 TGGTATTATTCAGAATACACAGG - Intergenic
1005076986 6:21918426-21918448 TGGTATTGAGGAGAAAACACAGG + Intergenic
1005519214 6:26583982-26584004 TGGTTTAATCCAGAAAACACTGG + Intergenic
1012466864 6:99525105-99525127 GGGAAATAACCAGTGAACACTGG - Intergenic
1012782280 6:103577943-103577965 GCCTATTCTCCAGAAAACACTGG - Intergenic
1014081786 6:117295600-117295622 GGTTAATAACCAGAATACATAGG + Intronic
1014155322 6:118102931-118102953 GACTATTAAGCACAAAACACGGG - Intronic
1018345916 6:162899325-162899347 TGGTAACAACCAGAAACCACGGG + Intronic
1020451797 7:8328070-8328092 GGGTAGTATACAGAAATCACTGG + Intergenic
1020487915 7:8741707-8741729 GGGTATTATCAATAAAATACAGG + Intronic
1020750217 7:12131291-12131313 GGGTATTAACCACAATACACAGG - Intergenic
1020945216 7:14596746-14596768 TGGTATTAACCAGAAAAATTGGG - Intronic
1023349577 7:39307443-39307465 AGGTATTAACCAAAAAACTTAGG - Intronic
1031628305 7:124016006-124016028 CGGTATTTACCAGCAATCACTGG - Intergenic
1032771386 7:135061426-135061448 GGATATGAACTTGAAAACACAGG - Intronic
1032924961 7:136593558-136593580 GCATATTAAGCAGAAAACAAAGG + Intergenic
1033604261 7:142914315-142914337 GGGCATTAAACAGGAAAGACTGG - Intronic
1034780814 7:153880727-153880749 AGGTATGAACCAAAATACACAGG - Intergenic
1037607790 8:20452131-20452153 GGGTATAAATCACAAAAAACGGG + Intergenic
1043145330 8:76647193-76647215 GATTAATAACCAGAATACACAGG + Intergenic
1044491745 8:92827440-92827462 GAGAACAAACCAGAAAACACAGG - Intergenic
1045345009 8:101286022-101286044 GGGTTTTACCAAGAGAACACTGG - Intergenic
1046080364 8:109363122-109363144 GGGTATTACTTTGAAAACACAGG - Intronic
1047525478 8:125630192-125630214 GGATAAGAACCCGAAAACACAGG + Intergenic
1050970984 9:11873855-11873877 GAGTCATAACCAGAAATCACTGG + Intergenic
1053234946 9:36444956-36444978 GTGGATTAACCAGAAATCTCTGG - Intronic
1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG + Intronic
1053433977 9:38063069-38063091 GGGAATCAACCAGGAAAAACTGG + Intronic
1057021062 9:91697928-91697950 GGGAATTATGCAGTAAACACGGG - Intronic
1059669131 9:116476864-116476886 GGGTTGTCACCACAAAACACAGG + Intronic
1059978641 9:119744952-119744974 GGGCATTGACAAGAAAACATGGG - Intergenic
1061001450 9:127905118-127905140 GGGTATGAACAGGAAAACAGAGG + Intronic
1186735746 X:12462227-12462249 GAGTATTATCTACAAAACACAGG - Intronic
1187811492 X:23182832-23182854 GGGTAAAAACCTAAAAACACAGG - Intergenic
1190720269 X:53142187-53142209 GGGTATTAAACAGATACCAAGGG + Intergenic
1193364081 X:80609446-80609468 GGTTTTTAACCAGAATACAATGG + Intergenic
1193802742 X:85955772-85955794 GGGTGTTAACCTCAAAAAACTGG + Intronic
1194702782 X:97134833-97134855 GGATAATAACCAGATAATACAGG - Intronic
1201638190 Y:16148701-16148723 GTCTGTTAACCAGAATACACTGG - Intergenic
1202160598 Y:21931243-21931265 GGGAATTATCTAGCAAACACAGG + Intergenic
1202230758 Y:22655132-22655154 GGGAATTATCTAGCAAACACAGG - Intergenic
1202312400 Y:23541033-23541055 GGGAATTATCTAGCAAACACAGG + Intergenic
1202558403 Y:26129561-26129583 GGGAATTATCTAGCAAACACAGG - Intergenic