ID: 921501460

View in Genome Browser
Species Human (GRCh38)
Location 1:215909298-215909320
Sequence ATGAATGAATAGATGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 980
Summary {0: 1, 1: 1, 2: 9, 3: 121, 4: 848}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921501458_921501460 -1 Left 921501458 1:215909276-215909298 CCAGGGGTTGGGGGAGGGCTGTA 0: 1
1: 1
2: 10
3: 120
4: 767
Right 921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG 0: 1
1: 1
2: 9
3: 121
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921501460 Original CRISPR ATGAATGAATAGATGGAACA CGG Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498218 1:2986368-2986390 ATGGGTGAATAGATGGAAAGAGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901161889 1:7183996-7184018 ATGAATGAATAAAGAAAACATGG + Intronic
901212127 1:7532746-7532768 ATGAATGAGTGGATGGATCAAGG + Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902620520 1:17648188-17648210 ATGAAATAATAGATGTAAAAGGG - Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
903579159 1:24358120-24358142 ATGAATGAAGGAATGAAACAGGG + Exonic
904067076 1:27761649-27761671 ATGAATGAACAGATTAAAAATGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905115062 1:35631597-35631619 ATGAATGAATAGTTTAAGCAAGG - Intronic
906953658 1:50354730-50354752 ATAAATAAATATATGGGACAAGG + Intergenic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907137613 1:52154592-52154614 ATGAATGAATATATGGGAGTGGG - Intronic
907233881 1:53026823-53026845 ATGAAATAATAGAAGGAAAAGGG + Intronic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
908097942 1:60759839-60759861 ATGAATGAATGAATTGAACCTGG + Intergenic
908557880 1:65275711-65275733 ATGAAGGAATATATGGGACAGGG - Intronic
909382909 1:75021132-75021154 ATGAAAAAATACATGGAAAATGG - Intergenic
910727935 1:90358510-90358532 ATGAATGAATATATAGATTAGGG - Intergenic
910728275 1:90361206-90361228 ATGAATGAATAAATGAAATAGGG + Intergenic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911501296 1:98688433-98688455 AAGAATGAAGAGATTTAACAAGG + Intronic
911621412 1:100069957-100069979 ATGAGTGAATAAATAGGACAAGG - Intronic
911671584 1:100614317-100614339 CTGACTGAATGGAAGGAACATGG - Intergenic
911909080 1:103609312-103609334 ATGAATGAATAAAAACAACATGG - Intergenic
911911399 1:103641542-103641564 ATGAATGAATAAAAGCAACGTGG - Intergenic
911913839 1:103670149-103670171 ATGAATGAATAAAAACAACATGG + Intronic
911917055 1:103710408-103710430 ATGAATGAATAAAAGCAACGTGG + Intronic
911918814 1:103735680-103735702 ATGAATGAATAAAAGCAACGTGG - Intronic
912454043 1:109786019-109786041 ATGACTGAACAGAGGGGACAAGG - Intergenic
912771519 1:112468183-112468205 ATGAATGAATAGAGAAAACTTGG - Intronic
912964571 1:114226567-114226589 TTGAATGAATAAATGATACATGG - Intergenic
913970459 1:143411404-143411426 ATGAATGAATGAATGAAAGAAGG + Intergenic
914699992 1:150123243-150123265 ATGAATGGATAAATAAAACATGG - Intronic
915016027 1:152734643-152734665 TTGAAAGAAAAGAGGGAACAGGG - Intergenic
915386369 1:155497288-155497310 ATGGATGAATAAATGAAATATGG + Intronic
915762647 1:158330450-158330472 ATGATTGAAAAGATGGATTAGGG + Intronic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
917680793 1:177365074-177365096 ATGAAGGAATAGGTGGAAGGTGG + Intergenic
917961496 1:180149170-180149192 CGGAATGAATAGGTGGAATACGG - Intergenic
918026238 1:180750331-180750353 ATCATTGAAGAAATGGAACATGG + Intronic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918356974 1:183713923-183713945 ATGAATGAATCAATCGAAAAAGG + Intronic
918530032 1:185509096-185509118 ATGAATGAATGAATAAAACAAGG - Intergenic
918710927 1:187729048-187729070 ATGAATGAATATACAAAACATGG + Intergenic
918767442 1:188505228-188505250 AGGAATTAATAGGTGGGACATGG - Intergenic
919026894 1:192183706-192183728 ATGAATGGATAAATGAAACGTGG + Intronic
919468792 1:197953438-197953460 ATGAATAAATACATGAAAAAGGG + Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
920919031 1:210282805-210282827 AAGAATGAGTAGATGGTTCAGGG - Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
922004948 1:221520816-221520838 ATTAATGATTAGATTGATCACGG - Intergenic
922035810 1:221846784-221846806 ATAAATGATTAGATGCAACTAGG - Intergenic
922093104 1:222416418-222416440 ATGAATGCATTGATGGGCCAAGG - Intergenic
922770812 1:228182167-228182189 ATGAATGAATCAATGAAAGATGG - Exonic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
922792938 1:228320371-228320393 ATGGATGACTAGATGGAAGGAGG - Intronic
923098048 1:230791101-230791123 ATGAATGAATAAACAGAACAGGG - Intronic
923844105 1:237709162-237709184 GTGAATGAAGCGATTGAACAAGG - Intronic
923858194 1:237867070-237867092 ATGAAAGAGTAGATGGCACAAGG - Intergenic
924467019 1:244307901-244307923 ATGAAATATTAGATGGAACCAGG + Intergenic
1062784658 10:252978-253000 ATGATTGAATTTAGGGAACAGGG + Exonic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063943610 10:11156343-11156365 CTGAATGAATAGATTTAATACGG - Intronic
1064142389 10:12801463-12801485 ATGAATGGATAGATAGATGACGG - Intronic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1064799025 10:19047631-19047653 AAGAATAAATATATGAAACAGGG + Intergenic
1064890319 10:20164262-20164284 TTGAATGAATAGAAGAGACAGGG - Intronic
1065304836 10:24358068-24358090 ATGAATGAAAGGCTGGAAGAAGG - Intronic
1065609068 10:27452927-27452949 ATGAATGAATAAAGAAAACATGG - Intergenic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1065860728 10:29870550-29870572 ATGAATGAGTGGATGGTAGATGG - Intergenic
1065860736 10:29870603-29870625 ATGAATGGATCGATGGTAGATGG - Intergenic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1066201754 10:33148561-33148583 ATGAATGAATAAATAGAAGATGG + Intergenic
1066994133 10:42547654-42547676 ATGAATGAATAAACAAAACATGG + Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067800858 10:49358649-49358671 ATGAATGGATAAAGGAAACATGG + Intergenic
1068816333 10:61319023-61319045 ATAAATGAATAGGTAGGACATGG + Intergenic
1070267436 10:74917565-74917587 ATAAATGAATGGATGAGACATGG + Intronic
1071191588 10:83108115-83108137 ATGACTGACTAGATGCAACAAGG + Intergenic
1071200441 10:83216069-83216091 CTGAATGAATAAATAGTACAAGG + Intergenic
1071870838 10:89792650-89792672 ACAAATAAATAGATGGAAAAAGG - Intergenic
1071945155 10:90635480-90635502 ATGAATCAATAAATGCAAAAAGG + Intergenic
1072316178 10:94205527-94205549 ATGACTAAATAAATAGAACATGG + Intronic
1072450411 10:95535058-95535080 ATAAATGAATGGATGGATGATGG + Intronic
1072456158 10:95578078-95578100 AGGGATGAATAGGTGGCACACGG - Intergenic
1073202977 10:101751121-101751143 ATGAATTAATAGAATGAACCAGG - Intergenic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073797733 10:107006377-107006399 GAGAATAAATAGATGGCACAGGG + Intronic
1074079230 10:110154414-110154436 ATGAATGAATAAACAAAACATGG + Intergenic
1074704308 10:116117708-116117730 AGGTATGAATAGATGGATGATGG + Intronic
1075517949 10:123124328-123124350 ATGAATGGATAAACGAAACATGG - Intergenic
1076406800 10:130217719-130217741 ATAAATGGATAAATAGAACATGG - Intergenic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1078101892 11:8334838-8334860 GTGACTGCATAGATGGAACCTGG - Intergenic
1078657308 11:13253704-13253726 ATGAATGAATAAATGAAAGGGGG + Intergenic
1078846757 11:15125523-15125545 ATGAATGAATAAGTGGACCTTGG - Intronic
1078896262 11:15599971-15599993 ATGAATGAAGAGAGAGAGCAAGG + Intergenic
1079385377 11:19974293-19974315 AAGGATGAATAGGTGGAGCATGG + Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079807369 11:24950223-24950245 ATAAATGAATGGATGGATGAAGG + Intronic
1080274586 11:30489443-30489465 ATGAATGAATGAATTCAACATGG + Intronic
1080369277 11:31615834-31615856 TGGGATGACTAGATGGAACAAGG - Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1084342315 11:68514068-68514090 ACGAATGAATGAATGAAACAAGG + Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543893 11:69804184-69804206 ATGGTTGAAAAGATGGAAGATGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084746993 11:71178197-71178219 ATGAATGAATAAATAGAATGTGG + Intronic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085555559 11:77417484-77417506 AGGAATGAATAGGTGAAGCACGG + Intronic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1085789057 11:79480260-79480282 ATGAATGAATAAATGGGGGAAGG + Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086052529 11:82610354-82610376 GTGAATGAATAAATAGCACAGGG + Intergenic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1086923454 11:92614121-92614143 ATGAATTAATAAATAAAACATGG - Intronic
1087231381 11:95669648-95669670 ATGGATGAATAGATAAAAAATGG - Intergenic
1087625557 11:100592196-100592218 ATGAATGAATAGATAAATAAGGG - Intergenic
1087808593 11:102583945-102583967 ATGAATGAAATGCTGGTACATGG - Intronic
1087871948 11:103305749-103305771 GTGAATGAGTTGATGGACCATGG + Intronic
1087910856 11:103751853-103751875 ATGAATGAATACATGAATAATGG - Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088522967 11:110719002-110719024 ATGAATGGATAAATGAAACGTGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088734050 11:112710668-112710690 GTGAATGAATACATGGCAGAAGG + Intergenic
1088810647 11:113389371-113389393 ATGAATGAATAGCTGGAAAGAGG - Intronic
1088986545 11:114914261-114914283 ATGACTGAGAAGAAGGAACAGGG - Intergenic
1089822310 11:121239757-121239779 CTGAATGAGAAGATGCAACAAGG + Intergenic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1089948137 11:122498974-122498996 TTGAATGAATGGATGACACATGG + Intergenic
1090268016 11:125366407-125366429 ATCAATGAATAGATGAATGATGG - Intronic
1090450905 11:126805567-126805589 ATTAATGAATAAATTAAACAAGG + Intronic
1090527261 11:127550916-127550938 ATGAATGAATGAATGAAATAGGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091759799 12:3079412-3079434 ATGGCAGAATAGATGGCACAAGG - Intronic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1092607406 12:10135714-10135736 ATGGATGAATAGAGAAAACAAGG - Intergenic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1093536413 12:20228996-20229018 TTGACTGAATAACTGGAACAAGG - Intergenic
1094206156 12:27843082-27843104 ATGAATGAATAAATGAACCCAGG - Intergenic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094780011 12:33780204-33780226 GGGGATGAATAGATGGACCATGG - Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1095902046 12:47338179-47338201 ATGACAGAATAGATGAAGCAGGG - Intergenic
1096320335 12:50606462-50606484 ATGAATGGATAAATAAAACATGG - Intronic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096914925 12:55020843-55020865 ATGCTTGAATAGTTGGCACAGGG + Intronic
1097326817 12:58286636-58286658 ATAAATGCAAAGATGTAACAGGG - Intergenic
1097603441 12:61723401-61723423 ATGAATTAATATAAGGAAAAAGG + Intronic
1097742533 12:63260898-63260920 ATGAATGAATGGAGGGAATCTGG + Intergenic
1097969150 12:65613716-65613738 AGGAATTAATAGATGGAACACGG + Intergenic
1098335437 12:69399752-69399774 ATGAATGAATAAATCGAATGTGG + Intergenic
1098481779 12:70970141-70970163 AGGAATGAAAAGACTGAACATGG - Intergenic
1098811593 12:75101192-75101214 TTGAATGGATATATGGAACCTGG - Intronic
1099354650 12:81618831-81618853 ATGAATGAATAGAAGTGCCATGG - Intronic
1099374895 12:81887041-81887063 ATAGATGGATAGATGGAAGAAGG + Intergenic
1100076260 12:90787876-90787898 ATGAATGAATAGATCAACTATGG + Intergenic
1100232571 12:92623218-92623240 ATGAAAGCATAGGTGGTACAGGG + Intergenic
1100272176 12:93036979-93037001 ATGAATGGATAAATGAAATATGG - Intergenic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1100598744 12:96094019-96094041 ATGAATGAAAACAGTGAACAAGG - Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1100913463 12:99391077-99391099 ACGAATGAATGGCTGGTACATGG - Intronic
1101090365 12:101279155-101279177 ATGAATGAATGAATGTAAAATGG + Intergenic
1101339149 12:103826094-103826116 ATGAATGAATAGAAAAAAGAAGG - Intronic
1101695779 12:107124644-107124666 AAGAATGAATACATAGATCATGG - Intergenic
1102043045 12:109812954-109812976 ATGAATGAGTAGATGATAGATGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102514748 12:113438895-113438917 ATGAATGCATGGATGGATTATGG - Intergenic
1102817358 12:115878015-115878037 CTGAATGAATAAATGTAACTTGG - Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103131019 12:118468732-118468754 ATGAATGAATAGATGGTGGCTGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103793075 12:123485301-123485323 ATGAATGAATGAATGAAACCCGG - Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104200603 12:126584772-126584794 ATGAATGAATACATTTAAAAAGG + Intergenic
1104277549 12:127343596-127343618 ATGAATGAATAGATTGAACCTGG + Intergenic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1105520843 13:21129577-21129599 TTGAATGATTAGATGGAAAATGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106106904 13:26741242-26741264 ATCAATGAGTAGAAGGATCATGG + Intergenic
1106385708 13:29283423-29283445 ATGAATGAATGGATATCACATGG + Intronic
1106430263 13:29674271-29674293 ATGAATGAATAAATGAAATGTGG - Intergenic
1106549254 13:30757375-30757397 ATGAAGAAAGAGATGGCACAGGG - Intronic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1107973616 13:45668791-45668813 ATGAATGAAATGAAGCAACAAGG - Intergenic
1108121425 13:47191285-47191307 ATAAATGAATAGAAGGGAGAGGG + Intergenic
1108237734 13:48426580-48426602 ATGAATGGCTAGTTGTAACAGGG - Intronic
1108290416 13:48954646-48954668 ATGAATGGATAAATGTAAGATGG - Intergenic
1108387823 13:49917486-49917508 ATGAATGATTGGATTGATCAAGG + Intronic
1108392982 13:49966097-49966119 AGGTATGAATAGGTGAAACACGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1110392885 13:74995649-74995671 ATGAATAAATAAATAAAACATGG + Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1110754380 13:79154212-79154234 AAGACTGAATAAATGGAAGAAGG + Intergenic
1111377128 13:87395694-87395716 ATGAAGGAATAAAAGGTACAAGG + Intergenic
1111819955 13:93200635-93200657 ATGATTGGATAAATGAAACATGG + Intergenic
1111908895 13:94287998-94288020 ATGAATGAATGGAATGAAAAGGG - Intronic
1112720246 13:102236163-102236185 ATGAAAGAATAGACAGAGCAGGG - Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1112779826 13:102887669-102887691 AAGAATGAATAGCAGGAAAATGG + Intergenic
1113167404 13:107457787-107457809 ATAAGTAAATAAATGGAACAGGG - Intronic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224755 13:108147454-108147476 GTGGCTGAATAGATGGAAGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224803 13:108147748-108147770 ATGGCTGAATAGGTGGAAGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113246086 13:108397235-108397257 ATGAATGAATAAATAAAATATGG + Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113646607 13:112001839-112001861 ATGAATGCAACGATGGAATATGG - Intergenic
1114282061 14:21202270-21202292 TTGAATGAATAAATAGAAAAGGG - Intergenic
1114371386 14:22092568-22092590 TTGAAAGAATAAAAGGAACAAGG + Intergenic
1114731489 14:24997321-24997343 ATGGTTGAATAGATGGCAGAGGG - Intronic
1114784179 14:25575674-25575696 ATGCAAGAATAGATAGTACAGGG - Intergenic
1114908066 14:27155051-27155073 GTAAATGAATAGATAGATCATGG - Intergenic
1114911134 14:27199234-27199256 AAAAATGAATACATGGAACATGG - Intergenic
1115634277 14:35276321-35276343 AAGAATGAGAAGAAGGAACAGGG + Intronic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116649156 14:47566879-47566901 ATGGATGACTAGATGCAACAAGG - Intronic
1116965614 14:51011647-51011669 AAAAATGAAAAGAAGGAACAAGG - Intronic
1117068602 14:52035251-52035273 AAGGATGCATAGGTGGAACATGG - Intronic
1118692337 14:68352199-68352221 ATTAATGAATAGATGGTATTGGG + Intronic
1118812239 14:69283823-69283845 ATGAATGAATACATGACACAGGG - Intronic
1118823964 14:69363683-69363705 ATGAATGAATGAATGGAATGAGG + Intergenic
1118976417 14:70681172-70681194 ATGAATGAATAAATAAAACTTGG + Intergenic
1119151936 14:72368609-72368631 ATGAATGAATTGAAGCAAGAGGG - Intronic
1120107419 14:80512523-80512545 ATGACTGAATGGATTGAAAAAGG - Intronic
1120356027 14:83435160-83435182 ATGGATGGGTAGATTGAACATGG + Intergenic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120532558 14:85650267-85650289 ATGAATGAATTAAAGGAACATGG - Exonic
1120695019 14:87635005-87635027 ATGAATGAAAAAATGTAACTTGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121799211 14:96759447-96759469 ATGAATGAATACATCGAAGGAGG - Intergenic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122794194 14:104197690-104197712 ATGGATGGATAGATGAAAGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1124433479 15:29627868-29627890 ATGGATGAATAAATGAAATATGG - Intergenic
1124452229 15:29805523-29805545 ATGAATGAATGAATGATACATGG - Intronic
1124803605 15:32859429-32859451 ATGAATGAAGACATGGAACTGGG - Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1125403393 15:39328108-39328130 ATGAACGAATACAAGGAATAGGG - Intergenic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1125577038 15:40763355-40763377 GTGACTGAATGGATGGAACCTGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1126354993 15:47785985-47786007 ATAAATGAATAGTTGCAAAAGGG - Intergenic
1126728922 15:51661739-51661761 ATGGATGAATAGATAGATAAAGG - Intergenic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127236569 15:57059421-57059443 AAGAATGAAAGGATGAAACAGGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127745816 15:61971064-61971086 TTGAAGGGATAGATGGAATATGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127874466 15:63099921-63099943 ATACATGTATAGATGGAAAAGGG + Intergenic
1128243095 15:66114932-66114954 AAGGAGGAAGAGATGGAACAGGG - Intronic
1128258827 15:66217691-66217713 ATGAAGGATTAGATGAAACAAGG - Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128533614 15:68472598-68472620 ATAAATGAAAAGATAGACCATGG - Intergenic
1128821463 15:70659196-70659218 ATGAATGATATGATAGAACAAGG - Intronic
1128934591 15:71734500-71734522 AGGGATGAAAAGGTGGAACAGGG + Intronic
1129647475 15:77449935-77449957 TAGGATGAATAGGTGGAACACGG - Intronic
1130041543 15:80409216-80409238 AGGAATGAATAGGTGGAGCATGG - Intronic
1130097903 15:80869929-80869951 ATGAAAGAAGAGATGGGAGATGG - Intronic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130531744 15:84752210-84752232 ATGACTGATCACATGGAACATGG - Intronic
1131500885 15:92965146-92965168 ATGAATCTTTAGATGTAACATGG + Intronic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132088935 15:98931938-98931960 ATGATGGAATTGATAGAACAAGG + Intronic
1132301385 15:100778301-100778323 ATGAATGAAGAAATGAAATAGGG - Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133376275 16:5289987-5290009 ATGAGTGGAGAGATGGAACATGG + Intergenic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133563019 16:6967181-6967203 ATCAATGTATAGATAGAAAATGG - Intronic
1133617225 16:7488842-7488864 ATGAATGTATAGATAGATAATGG - Intronic
1133751030 16:8725594-8725616 ATGAATGAATAAACAAAACATGG - Intronic
1134226192 16:12392437-12392459 ATGGATGAATGGCTGGAGCAGGG - Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134632236 16:15765157-15765179 ATGAATGAATAAATGGATAGAGG + Intronic
1135831361 16:25776774-25776796 AGGAGAGAAAAGATGGAACAAGG - Intronic
1135898503 16:26432832-26432854 ATGAATGAATGAATGGAAGGAGG + Intergenic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137579847 16:49627185-49627207 ATGGATGGGTAGATGGAAAATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137934553 16:52622071-52622093 ATGAAAAAATAGAAGAAACAAGG + Intergenic
1138387547 16:56646328-56646350 CTGACTGGATAGATGGCACACGG + Intronic
1139309549 16:66016958-66016980 CTGAATGAATAGTTGGTGCATGG + Intergenic
1139560598 16:67739265-67739287 ATGAAGTAATGGATGGAAAAGGG - Intronic
1139795128 16:69476717-69476739 ATGAAAGAATAAATTGACCATGG - Intergenic
1140153672 16:72400027-72400049 ATAAATAAATAGATGGAAATAGG - Intergenic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1140951728 16:79824971-79824993 ATGAATGCATGGATGGTAGATGG - Intergenic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141495151 16:84404573-84404595 ATGAATGAATGCATGAAACATGG - Intronic
1141619882 16:85231565-85231587 ATGAATGAGTAGATGATAGATGG + Intergenic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143660235 17:8320078-8320100 TTGAATGAATAAATGAAACACGG - Intronic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1144000230 17:11047311-11047333 ATGAATGAATAAACAAAACATGG + Intergenic
1144481087 17:15629575-15629597 ATGAATGAATGGATCAAATATGG - Intronic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144580655 17:16457218-16457240 ATGAATGAATTTATGGATGAGGG - Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145261027 17:21354972-21354994 ATGAATGAATGAATGGAAGTTGG + Intergenic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148823047 17:50371776-50371798 ATGAATGAATAGATGTTTAAAGG - Intronic
1149047147 17:52259994-52260016 GTGAATGAATAGATATACCAGGG - Intergenic
1149259320 17:54861705-54861727 ATGAATGAAATGAAGGAAAATGG - Intergenic
1149453737 17:56770531-56770553 GTGTATGAATAGATGGATGATGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1149907936 17:60543891-60543913 ATGAATGAATAAATGAAATGTGG - Intergenic
1150374006 17:64665082-64665104 ATAAATGAAAACATAGAACAGGG + Intergenic
1150458700 17:65329120-65329142 ATGAATGAATAAATATGACAAGG + Intergenic
1150768722 17:68023556-68023578 GAGAATGAATAGGTGGAATAAGG - Intergenic
1150845373 17:68651827-68651849 GTGAATGAATAAATGGTAAAAGG - Intergenic
1151009759 17:70481164-70481186 ATGAATAAATAGCTGCAACTGGG - Intergenic
1151428790 17:74048788-74048810 ATGAATGAATGAAAGGAAGAAGG + Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152605841 17:81289623-81289645 ATAAATAAATAAATGGAATAAGG + Intronic
1153073666 18:1136248-1136270 ATGAATGAATAAATAGAATGTGG - Intergenic
1153103624 18:1502381-1502403 ATGAATGAATGAATGATACAAGG - Intergenic
1153279111 18:3397487-3397509 ACCATTGATTAGATGGAACAGGG + Intergenic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1153628081 18:7040758-7040780 ATGAATGGATATATGAAACATGG + Intronic
1153645695 18:7194292-7194314 ATGCATAAATACAAGGAACATGG - Intergenic
1153716840 18:7858769-7858791 ATTATTTAGTAGATGGAACAAGG - Intronic
1153758008 18:8302740-8302762 ATGAATGGTTAGATGGATGATGG + Intronic
1154338035 18:13481648-13481670 ATGAATGAATACATGAGCCATGG - Intronic
1154508748 18:15070891-15070913 ATGAATGAATAGTTGCATAATGG - Intergenic
1155276010 18:24188119-24188141 AGGAAGGAATAGATGGACCAGGG + Intronic
1155871685 18:31037551-31037573 ATGAATGAATGAATGTTACAAGG - Intronic
1156069234 18:33186021-33186043 ATGACTGAATAGATGAAATATGG - Intronic
1156133250 18:34004217-34004239 ATCAATCAATACATGTAACATGG - Intronic
1156371181 18:36472789-36472811 ATGAATGGATAGATGCAATGTGG - Intronic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1157348093 18:46858790-46858812 ATGAATGACTAGATGTGAGAAGG + Intronic
1158389163 18:57029874-57029896 ATGAATGATTAGAAGCAGCAGGG - Exonic
1158529131 18:58242489-58242511 ATGAATGAATGAATGAGACAGGG + Intronic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159271956 18:66164355-66164377 ATAAAGGAAGAGATGGAATATGG - Intergenic
1159725368 18:71951316-71951338 GTGAATCAAGAGATGTAACAAGG - Intergenic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1160549949 18:79688027-79688049 AGGAATGTAAAGAAGGAACAAGG - Intronic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1160960241 19:1717713-1717735 ATGGATGGATGGATGGAACATGG + Intergenic
1161227518 19:3153953-3153975 ATGTATGAGTAGATGGATAATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161287552 19:3476822-3476844 ATGAGTGAATAGATGGGTGATGG + Intronic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161498838 19:4602114-4602136 ATAAATGAATGGATGGATTATGG + Intergenic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161633657 19:5373398-5373420 CTGGATGAATGGATGGCACATGG + Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1162062871 19:8107378-8107400 ATGAATGGGTAGATGGAGAATGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162424739 19:10587629-10587651 ATCAATGAATCGATGGAAGATGG - Intergenic
1163095034 19:15051049-15051071 ATTAATGGATAGATGGTAGATGG + Intronic
1163172078 19:15538483-15538505 ATGAATGAATTAATGAAGCAAGG - Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1164322958 19:24167204-24167226 CTGAATGAGAAGATGGAACGAGG - Intergenic
1164648737 19:29876912-29876934 ATGACTGAATGAATGGATCATGG - Intergenic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1165931205 19:39360359-39360381 ATGAATGAATATATGAATCAAGG + Intronic
1165975967 19:39676949-39676971 ATGAATGAATGAATGAAAAAAGG + Intergenic
1166572549 19:43807065-43807087 ATGAATGAATAAATAGAATGCGG - Intronic
1166771798 19:45287770-45287792 ATGAATGAATGGGTAGAAGAAGG - Intronic
1166798690 19:45443340-45443362 ATGAATGAATCGAATGAAAAGGG + Intronic
1167639274 19:50671692-50671714 ATGAATGAATGGATGGAATCGGG + Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925649 2:8668234-8668256 ATAAATGAATGGATGGATGAAGG + Intergenic
926040847 2:9671856-9671878 AGGGATGAATAGACGGAGCAAGG - Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926313361 2:11691454-11691476 AGGAAAGCATAGATGGGACACGG - Intronic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926613945 2:14976131-14976153 ATGAAGTAATAACTGGAACACGG + Intergenic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
927803649 2:26124983-26125005 GTGAATGAATAAACAGAACATGG - Intronic
927860956 2:26559606-26559628 AAGAATGAATAGCAAGAACAAGG - Intergenic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
929240809 2:39651349-39651371 ATGAATGACATGATGGAAGAAGG - Intergenic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930247879 2:49003605-49003627 ATGAACAAATAGATGGAAGCAGG + Intronic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
930669278 2:54131351-54131373 ATCAATGAATAGATGGTGGAAGG + Intronic
930699461 2:54444862-54444884 TTGAGTGACTAGAAGGAACAAGG + Intergenic
931219429 2:60276030-60276052 ATGAATAAATAAATGGCACAGGG - Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931494500 2:62787684-62787706 ATGAAAGAATAGATGAAAAAAGG + Intronic
932912449 2:75819607-75819629 ATGAATGAATAGATGATGGATGG - Intergenic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933852022 2:86375746-86375768 ATGAATGAATAAAGATAACATGG - Intergenic
934175154 2:89572330-89572352 ATGAATGAATGAATGAAAGAAGG + Intergenic
934285470 2:91646684-91646706 ATGAATGAATGAATGAAAGAAGG + Intergenic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
934613919 2:95759781-95759803 ATGAATGGATGGATGGCAGATGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
936523040 2:113224030-113224052 ATGGAGGAATAGATTGAAAAGGG + Intronic
936752918 2:115667862-115667884 ATGCATGATTAGATGGGAAATGG - Intronic
937130061 2:119503655-119503677 ATGGAAGAATAGGTGGAACGTGG + Intronic
937317764 2:120942857-120942879 ATGAATGAATGAATGAAAGAGGG - Intronic
937458246 2:122062634-122062656 ATGAATGAATAAAGGAAAGAAGG - Intergenic
937611417 2:123865978-123866000 ATGTATGAATAAAGAGAACAAGG - Intergenic
937612995 2:123885907-123885929 ATGAATGAATAAATAAAATATGG - Intergenic
937959817 2:127448753-127448775 AGTCATGAATAGATGGGACATGG - Intronic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
940494015 2:154402547-154402569 ATGTTTGAATATATGGCACAAGG - Intronic
940845315 2:158634705-158634727 ATGATTGAAAACATGTAACACGG - Intronic
941112613 2:161432291-161432313 ATGAAAGAAAAGTTGGAAGAAGG - Intronic
941580256 2:167288262-167288284 ATGAATGTATAAATGTTACATGG - Intergenic
942122034 2:172787548-172787570 ATGAATGAATAGATAAATGAAGG + Intronic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942796826 2:179830714-179830736 AGAGATGAATAGGTGGAACATGG + Intronic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
943088665 2:183348147-183348169 ATGAATGAATGAATGTTACAAGG - Intergenic
945222363 2:207497827-207497849 ATGAATTTGAAGATGGAACAAGG - Intergenic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945600075 2:211850648-211850670 ATGTATGATTAGAAGGAGCAAGG + Intronic
946453964 2:219806336-219806358 ATGAATGAATAAAGAAAACATGG - Intergenic
947133133 2:226950422-226950444 GTGAATGAATAAATAAAACATGG - Intronic
948237831 2:236403599-236403621 CTGGATGAATAGGTGTAACATGG + Intronic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1169203167 20:3725023-3725045 AAGGATGAATAGGTGGAGCACGG + Intergenic
1169649307 20:7849248-7849270 ATGAGTGAAAGGATGGAAAAAGG + Intergenic
1169701773 20:8454988-8455010 ATGAATGAATGGGTGAAACCTGG + Intronic
1170335175 20:15262422-15262444 GTGAATGAATAAATAAAACATGG - Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170586954 20:17741882-17741904 ATGAATGAATAGAGAAAACGTGG + Intergenic
1170679588 20:18514204-18514226 ATGAATGTAGAGCTGGAAGACGG + Intronic
1172208542 20:33181637-33181659 ATGCATGAATGGATAGATCAGGG - Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172978777 20:38925961-38925983 ATGAATGAATACATGGTTAAAGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173532131 20:43778012-43778034 AGGGATGAATAGGTGGAGCAGGG + Intergenic
1173545190 20:43892201-43892223 ATGAATGGATAAACGAAACATGG + Intergenic
1173556239 20:43968065-43968087 GTGAATGAATAGATGGGTGAGGG - Intronic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175301570 20:57946889-57946911 ATGAATGAGGAATTGGAACATGG + Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175920581 20:62448880-62448902 ATAAATGAATAGAGGGTGCAGGG - Intergenic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1176789328 21:13300856-13300878 ATGAATGAATAGTTGCATAATGG + Intergenic
1177065719 21:16432472-16432494 ATGAATGAATAGTTCTAACTGGG - Intergenic
1177237283 21:18409026-18409048 ATGAATGAACTCATGGAATATGG - Intronic
1177563505 21:22787264-22787286 CTCAATGAATTGATGAAACAAGG + Intergenic
1177988488 21:28009017-28009039 ATGAATGAATAGTTGCATAATGG + Intergenic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178672586 21:34604886-34604908 ATGAATGGATTGATGGAGCCAGG + Intronic
1178788779 21:35678658-35678680 ATGAATGAATGGATGCAAGGAGG + Intronic
1178795988 21:35744948-35744970 ATGAATGAATACAGGGACCCAGG - Intronic
1179125937 21:38590648-38590670 ATGGATGAATACATGGATGATGG - Intronic
1179474384 21:41633982-41634004 ATGAATGAATGGGTGGTAGATGG - Intergenic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180948399 22:19709245-19709267 ATGAATGAAGAGATGTGAAATGG - Intergenic
1181383001 22:22521753-22521775 ATGAATGAATGAATGAGACAAGG - Intergenic
1181579410 22:23819309-23819331 ATGAATGAATAAATGAAAACAGG - Intronic
1181683507 22:24512902-24512924 GTGAATGGATAAATGAAACATGG - Intronic
1181824938 22:25507437-25507459 ATGAATGAATTAATGGAAGGAGG - Intergenic
1182006529 22:26964797-26964819 ATGAATGGATAGATAGATTAGGG - Intergenic
1182006546 22:26964873-26964895 ATGAATGGATAGATAGATTAGGG - Intergenic
1183068263 22:35378647-35378669 CTGAATGAATAGATGCTTCAAGG - Intergenic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183340984 22:37281365-37281387 ATGAATGAATGAAGGGAACATGG - Intergenic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
1184346838 22:43918721-43918743 ATGAATGGATAGACCCAACAGGG + Intergenic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
1184950462 22:47838588-47838610 ACGAATGGGTAAATGGAACAAGG + Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018791 22:48361145-48361167 ATGAATGGATAGATAGATGATGG + Intergenic
1185018810 22:48361329-48361351 ATGAATGGATAGATAGATGATGG + Intergenic
1185018852 22:48361708-48361730 ACGAATGGATAGATGGATGATGG + Intergenic
1185064731 22:48625831-48625853 AGGAATGAATAGTTGGACCCAGG - Intronic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185262641 22:49877884-49877906 ATGAATGGATACACGCAACACGG - Intronic
1185311239 22:50156043-50156065 ATGAATGAATGAATGAGACAGGG - Intronic
949441695 3:4088211-4088233 TGGAAGGAATAGATGGAAGAAGG - Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950009635 3:9713660-9713682 ATAGATGAATAGATGGCAAATGG + Intronic
950341573 3:12250669-12250691 ATGAATGAATAAATAAAACGTGG + Intergenic
950352852 3:12374210-12374232 AGGAATGAATAGGTGGAGTATGG + Intronic
950734819 3:14998144-14998166 ATGAATGGATAAATAAAACATGG - Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952633311 3:35496193-35496215 ATCAATGAATAGGCGAAACACGG - Intergenic
952683796 3:36126091-36126113 ATGACTGAAAAGATGGAAAAAGG + Intergenic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955590784 3:60533091-60533113 GTGAATGAATTGATGGCAGATGG - Intronic
955611155 3:60758679-60758701 TTGATTGAATAAATGAAACATGG - Intronic
955645153 3:61129434-61129456 ATGGATGAATAGTTGGAACATGG + Intronic
955696557 3:61642835-61642857 ATCAATGAATTGATGGATCTGGG + Intronic
955706579 3:61733747-61733769 ATGAAACAGTAGAAGGAACAGGG - Intronic
955762575 3:62303665-62303687 GTGAATGAATAGATTGGACTTGG - Intergenic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956548348 3:70432796-70432818 AGGGATGAATAGGTGGAGCACGG - Intergenic
956984250 3:74678884-74678906 ATGAATGAATATATAAAATATGG + Intergenic
957110680 3:75952775-75952797 AGCGATGAATAGATGGAGCAAGG - Intronic
957373184 3:79322781-79322803 AGGAATGAAGAAATGGAAGAAGG + Intronic
958475727 3:94578837-94578859 AGGGATGAATAGGTGGAGCAAGG + Intergenic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
958955666 3:100463655-100463677 ATGAATGAAATGAGGGAAAAGGG + Intergenic
959034363 3:101343422-101343444 ATGAATGAATAAATAATACATGG - Intronic
959129462 3:102335799-102335821 ATGAATGAATAGATGTTATAAGG - Intronic
959148664 3:102581118-102581140 ATCAAAGAATAAATGGAACTTGG - Intergenic
959258836 3:104049088-104049110 ATGAACGAATAGATAGAAGTAGG + Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959686606 3:109154091-109154113 ATGAATCAATAAATGATACAAGG - Intergenic
959921617 3:111874508-111874530 CTGAATGAGGACATGGAACAAGG - Intronic
960323447 3:116265674-116265696 AGAAATGATTAGATTGAACAGGG + Intronic
961679481 3:128589531-128589553 ATGGATGAATAGACAGAATATGG - Intergenic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
962823877 3:139081166-139081188 ATGACTGAAAAGTTGGAACTTGG + Intronic
962880866 3:139575198-139575220 ATGAATGAATACATTTAACCTGG + Intronic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
964139727 3:153383872-153383894 GTTAATCAATAGATGTAACAAGG + Intergenic
964967651 3:162517181-162517203 CTGAAGGAATACATGGAACCAGG - Intergenic
965222530 3:165945113-165945135 ATAAATGGATAGATGAAAGAAGG + Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
966114151 3:176441328-176441350 TAGTATGAATAGATGGAAAATGG + Intergenic
966963715 3:184968258-184968280 ATGAATGAATAAATGAAATGTGG - Intronic
967437900 3:189471913-189471935 ATGAATTAATAAATAGAATATGG - Intergenic
967466543 3:189812951-189812973 ATATATGAATAGATGGTATAGGG + Intronic
968885399 4:3328006-3328028 ATGAATGGATAAAGGAAACATGG + Intronic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
969129202 4:4978968-4978990 ATAAATGAAGTGATGGAGCAAGG - Intergenic
969166124 4:5315628-5315650 AGGAAGGAATAGATGGAGTAAGG + Intronic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969528493 4:7716524-7716546 GTGAATGAATAGATGGATGGTGG - Intronic
969528517 4:7716657-7716679 ATGAATGAATAGATAGATGGTGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
970228924 4:13889042-13889064 ATGAAAGAATAAAGGGAAAAGGG - Intergenic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
971059947 4:22956599-22956621 ATGAATGAATGTATCAAACACGG - Intergenic
971075956 4:23150099-23150121 ATGAATGAATATAGAAAACATGG + Intergenic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971755610 4:30704240-30704262 AGCAATAAATAGCTGGAACATGG - Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
973011809 4:45084867-45084889 ATGAATGAATAGACGGACACTGG + Intergenic
973027071 4:45285251-45285273 ATGTATGCATTTATGGAACATGG - Intergenic
973794161 4:54406695-54406717 ATGAATGAATGAATGAAACAAGG + Intergenic
974092323 4:57324347-57324369 GTGAATGAATAAATGGAACCAGG + Intergenic
974662390 4:64909179-64909201 ATGAATGAATAAACAAAACATGG - Intergenic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
975462507 4:74670942-74670964 ATGAATGAATATATGAAGAAAGG + Intergenic
975768410 4:77694091-77694113 ATGAATGAATAAAGAAAACATGG - Intergenic
975874414 4:78819088-78819110 ATGAATGAATCAATGAAAGATGG + Intronic
975874481 4:78819752-78819774 ATGAATGAATCAATGAAAGATGG - Intronic
976493507 4:85699126-85699148 AGCAAAGAATAGATGGGACAAGG - Intronic
976528643 4:86123272-86123294 ATGAATGAATAAATAAAATATGG - Intronic
976942042 4:90714229-90714251 ACGAATAAATAGATAGAAAAAGG - Intronic
977000329 4:91490357-91490379 ATGGATGAATAAAGGAAACATGG + Intronic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977419580 4:96781323-96781345 ATAAATGAATAAATAAAACATGG + Intergenic
977444209 4:97108695-97108717 AAGAATGGAGAAATGGAACAAGG - Intergenic
977616496 4:99092477-99092499 AGAAACGAATAAATGGAACAGGG + Intergenic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
977670430 4:99688793-99688815 ATGAATGAATAAAGAAAACATGG - Intergenic
978003218 4:103582695-103582717 ATGAATGGATAAATAAAACATGG - Intergenic
979467847 4:121060963-121060985 ATGAGTGAGTAGATGTACCAGGG + Intronic
979516073 4:121611710-121611732 AGGGATGAATAGATGAAGCACGG + Intergenic
981634866 4:146865165-146865187 AGTAATGAATAGATTGAAGAAGG - Intronic
982687467 4:158508410-158508432 ATGAATGAATAGAGAAAATATGG + Intronic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983649120 4:170020952-170020974 ATTAATGAATGGATGGAATATGG + Intronic
983730932 4:170992227-170992249 ATGGATGACTAGATGCAACCAGG - Intergenic
983951317 4:173645987-173646009 ATGAATGAATAAAGAAAACATGG - Intergenic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
985383184 4:189417060-189417082 ATGAATGAATAAATGCAAGGAGG - Intergenic
985712939 5:1440226-1440248 ATAGATGAATAGATAGAAGATGG + Intronic
985804869 5:2035723-2035745 ATGAATGAATAATGGGAAAAGGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986279271 5:6310185-6310207 ATGAATGAATGAATGAAAGACGG - Intergenic
986342001 5:6797266-6797288 ATGAAGGAATAGAAAGAGCAGGG - Intergenic
986887677 5:12260041-12260063 ATGGATGAATAATTGGAAAATGG - Intergenic
987413809 5:17642044-17642066 ATGAATGAAGAGATTAGACAGGG + Intergenic
987874321 5:23660137-23660159 ATGAATGAATAAATGAAATACGG + Intergenic
988149147 5:27353571-27353593 AGGAATGCAAAAATGGAACAGGG + Intergenic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
989080329 5:37612727-37612749 ATGAATGACTGGCTGGAGCAAGG - Intronic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
990761875 5:59138712-59138734 ATGACTGAATGGATGATACAGGG - Intronic
990887398 5:60610148-60610170 ATGAATGAATACATGAATGAAGG + Intronic
991120108 5:63003114-63003136 ATGAATGAATAGATAAAATGTGG - Intergenic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
991957226 5:72007234-72007256 ATGAATGAATGGCTGAAAGATGG + Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992411937 5:76513713-76513735 AGGGATGAATAGGTGGAGCATGG + Intronic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
993611513 5:90060093-90060115 ATGAATGAACACATTAAACATGG - Intergenic
993685525 5:90933108-90933130 GTGAATGAATTGATGGGACCAGG - Intronic
994036352 5:95206138-95206160 ATGAGTGAATAAATAAAACATGG + Intronic
994784063 5:104132956-104132978 ATGGATGACTAGATGGAGCCAGG - Intergenic
995031553 5:107487473-107487495 ATGAATGAATAAAGGAAAGAAGG + Intronic
995140037 5:108725514-108725536 ATAAATGAATAAATGAATCAAGG + Intergenic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996318647 5:122189675-122189697 ATGAAGGAATATCTGGATCATGG - Intergenic
996796371 5:127352777-127352799 AACAATGAATAGAAGCAACAGGG + Intronic
996840880 5:127846314-127846336 ATGAATGAATACATGAAACAAGG + Intergenic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
997286134 5:132679981-132680003 ATGAATGAATGGGTTGACCAAGG - Intronic
997343417 5:133165454-133165476 ATGAATGAATAAATGAAATGTGG - Intergenic
997598958 5:135126532-135126554 ATGAAAGAATAAATTAAACAAGG - Intronic
997672460 5:135686721-135686743 AAGAATGAATGAATGGAAAAAGG + Intergenic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
998726166 5:145017186-145017208 AGGAAAGAAGACATGGAACATGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
999185628 5:149706259-149706281 ATAAATGATTGGATGGAAAAAGG - Intergenic
999568630 5:152893581-152893603 ATGATTGATTAGAGGAAACATGG + Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
1000580399 5:163028686-163028708 AGAACTGAATAGATGGAACATGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001794001 5:174486612-174486634 AGGATTGAATAGATGAAGCATGG + Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002112705 5:176929657-176929679 ATGAATGACTAGGTAGAATATGG + Intronic
1002328786 5:178427808-178427830 AGGGATGAATAGTTGGAGCACGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002769342 6:277494-277516 ATGAATGGATAGACAAAACATGG - Intergenic
1002809083 6:608573-608595 ATAAAGGAATATATGGAAAAAGG + Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003014482 6:2456989-2457011 AGGGATGAGTAGTTGGAACACGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004115064 6:12758781-12758803 AGGAAAGAAGAGATGGAACTAGG + Intronic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1004568432 6:16821572-16821594 TTGAATGAATAGAAGGTACCAGG - Intergenic
1004640426 6:17509830-17509852 ATGAATGGATAAATAAAACATGG + Intronic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005118089 6:22360502-22360524 ATGAATGAATATTTGGAAAAAGG + Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005925981 6:30446089-30446111 ATGAATCCAAAGATGGAAGAGGG - Intergenic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1007550317 6:42724443-42724465 AGGAATGAATAGGCAGAACATGG - Intergenic
1007792873 6:44322815-44322837 ATGAATGGATAAATGGAAAGTGG + Intronic
1008351245 6:50492869-50492891 ATGAATGAATAGATGATCAATGG + Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008480348 6:51979383-51979405 ATGAATGAATAAATGTTAAATGG + Intronic
1008551606 6:52638222-52638244 ATAAATGAATAGAGAGAACGAGG + Intergenic
1008706977 6:54174112-54174134 ATGAATGAATAAAGAAAACATGG - Intronic
1008741163 6:54610117-54610139 ATGAATGAATGGAGGGATCAAGG - Intergenic
1009211582 6:60869337-60869359 ATGAATGAATGAATGAAGCATGG - Intergenic
1010156850 6:72804542-72804564 ATGAGTGGATAAATAGAACATGG - Intronic
1010466506 6:76173128-76173150 AGGAATGTATAGGTGGAGCATGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011278141 6:85649747-85649769 AGAAATGAATACATTGAACATGG + Intergenic
1011441583 6:87392647-87392669 ATAAGTGAATAGAAGGAAAATGG + Intronic
1011582117 6:88880204-88880226 ATGAATGAATGAAAGGAAGAAGG + Intronic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1013046707 6:106492849-106492871 TTGAATGAATAAATGAAATACGG + Intergenic
1013088590 6:106877620-106877642 AAGGATGAATAGTTTGAACATGG - Intergenic
1014105895 6:117560432-117560454 AAGACTGGATAGATGGAATAGGG + Exonic
1014435584 6:121417308-121417330 ATAAGTAAATAGATGGAAAATGG + Intergenic
1014791196 6:125674360-125674382 ATGAATCAATGGAAGGACCAAGG - Intergenic
1015095742 6:129413222-129413244 ATGATAGAATAAAAGGAACAAGG + Intronic
1015115206 6:129640825-129640847 ACAAATGTATAGATGGCACAAGG + Intronic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1016182454 6:141163852-141163874 AGTAATGAATGGCTGGAACAAGG - Intergenic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017117411 6:150991314-150991336 ATAAATGTATACATGGAACATGG + Intronic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1018437222 6:163773158-163773180 ATGAATGAATAAACGGACCTGGG + Intergenic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1018917116 6:168140460-168140482 ATGAATGAATAAAGAAAACATGG - Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019932055 7:4230295-4230317 ATGAATGAATTGATGAAGGAAGG + Intronic
1020113251 7:5459920-5459942 ATAAATAAATAAATGGCACAAGG + Intronic
1020936326 7:14469213-14469235 ATAAATGAAGAAATGGAACTTGG - Intronic
1020983453 7:15101296-15101318 ATAAATGAAGAGGTGGTACATGG - Intergenic
1021506207 7:21388373-21388395 AGGAATGAATAGGTGGAGCATGG - Intergenic
1021815006 7:24438315-24438337 ATGAATGAATAAGTGTAATAGGG + Intergenic
1022267054 7:28767220-28767242 ATAAATGCATACATGGAACAGGG - Intronic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1022415169 7:30171311-30171333 ATGAATGAATGCATGGGTCATGG + Intergenic
1022454335 7:30545395-30545417 CTGAATGAGAAGATGGAACGAGG + Intronic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1022970860 7:35515649-35515671 ATGAATGGATAAATGAAATATGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023150201 7:37194910-37194932 ATGAATGAATAGATCAATTAAGG - Intronic
1023309242 7:38866925-38866947 ATGAATGGATAGACAAAACATGG + Intronic
1024119048 7:46219087-46219109 ATCAAAGAATAGTTGGAAAAGGG - Intergenic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1024781142 7:52849848-52849870 ATGAATGAATAAATGAACCATGG - Intergenic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1025113153 7:56236189-56236211 ATGAATGAATGAATGAAATAGGG + Intergenic
1025851655 7:65249514-65249536 ATGTATGAAAAGATGGAAATGGG + Intergenic
1026203537 7:68235736-68235758 ATGGATGAATGGATGGAAGGTGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027220427 7:76210475-76210497 ATGAATGAATGAATGAATCAAGG - Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1027515018 7:79130976-79130998 ATAAATTTATAGAAGGAACAGGG + Intronic
1028120455 7:87051179-87051201 AAGAATAAATCGCTGGAACATGG + Intronic
1028557121 7:92136141-92136163 ATGACTGATTAGATGAAGCATGG - Intronic
1029683308 7:102127775-102127797 ATGAAGGCATAGAAAGAACAGGG - Intronic
1029946139 7:104535087-104535109 AGTAATGAACAGCTGGAACATGG - Intronic
1030996687 7:116367986-116368008 ATGAATGAAAACAAGGAAAAGGG - Intronic
1031050799 7:116943147-116943169 ATGATTTAGTAGATGCAACATGG - Intergenic
1031265929 7:119580153-119580175 ATGAATGAATAAAAGAAAAAAGG + Intergenic
1031446694 7:121863859-121863881 ATGAATGAATTCATTGAAGAAGG - Intergenic
1032015332 7:128376518-128376540 AGGGATGAGTAGGTGGAACATGG - Intergenic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032751372 7:134845288-134845310 ATGAATGAATGAATGGAAAGAGG + Intronic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1033937283 7:146602908-146602930 ATAACGGAAGAGATGGAACATGG - Intronic
1034552341 7:151829638-151829660 ATGAATGAATAAACAGAACACGG + Intronic
1034604844 7:152302634-152302656 ATGAATGAATGAATGAAAGAAGG - Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1035288554 7:157822215-157822237 ATGAGTGTATAGATGGATAATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1035947497 8:3981561-3981583 ATGAGTGATGTGATGGAACACGG - Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1036524191 8:9519706-9519728 ATGAATGAATATCAGGAACTGGG + Intergenic
1036646763 8:10615897-10615919 ATTAATAAATAAATGGAACAGGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038263239 8:26016391-26016413 ATGAATGAATGAATGCAACTGGG - Intronic
1038728046 8:30099251-30099273 ATGAATAAATAAATATAACAGGG + Intronic
1039091913 8:33839960-33839982 ATGAATGGATAAATAAAACATGG - Intergenic
1039126716 8:34211519-34211541 ATGAATGAATAGAAGAAAGTAGG + Intergenic
1039558087 8:38491213-38491235 ATGAATGAGTAGCTGAAATAAGG + Intergenic
1039664872 8:39514220-39514242 ATGAATGAATATATGTTTCAAGG - Intergenic
1039713773 8:40086924-40086946 ATTAATGAATAAATGAACCAGGG - Intergenic
1040983668 8:53270412-53270434 ATGAAGGGTTAGATGGAAAATGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041532362 8:58883944-58883966 ATGAATGGAAAGAAGCAACAAGG + Intronic
1041546199 8:59046133-59046155 TTGAATGAAAACATGCAACATGG - Intronic
1041782050 8:61587694-61587716 ATATATGAAAAGATAGAACATGG - Intronic
1041854002 8:62428217-62428239 ATGAATGAATAAAGAAAACATGG - Intronic
1041970926 8:63741821-63741843 ATGAATGATTAAATGAATCAAGG - Intergenic
1042048255 8:64679169-64679191 ATGAATGAATATATGAAATGTGG - Intronic
1042819709 8:72916671-72916693 ATGAATGAATTGAATGAAGATGG + Intronic
1043255457 8:78131084-78131106 ATGAATCATCAGAGGGAACAGGG + Intergenic
1043375789 8:79647886-79647908 ATGAATGAATAAATGATAAATGG - Intronic
1043682606 8:83048609-83048631 AAAAATTAATAGATGGAACATGG - Intergenic
1043860427 8:85310176-85310198 ATGAATGTATAGATGAACTAAGG - Intergenic
1044392945 8:91673943-91673965 ATGCATGAATAAATGAAAGAAGG - Intergenic
1044460341 8:92437174-92437196 ATGACATAGTAGATGGAACACGG - Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1045141438 8:99289049-99289071 ATGAATGAATGAATGAAAGAAGG + Intronic
1045242274 8:100413016-100413038 ATGAATGAATGAATGAAAGAGGG - Intergenic
1045537811 8:103049242-103049264 ATGAGTGAATAAATAGAACCTGG - Intronic
1047272484 8:123375624-123375646 ATGAATGAATAAACAAAACATGG + Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048128956 8:131670600-131670622 ATGAATGAATAAAGAAAACATGG - Intergenic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048346761 8:133581609-133581631 ATGAATGAATGAATGAAAGAAGG - Intergenic
1048641353 8:136366148-136366170 AGGGATGAGTAGGTGGAACATGG + Intergenic
1048670862 8:136718111-136718133 ATGAAAGAATAAATGGCACGTGG - Intergenic
1048676321 8:136786176-136786198 ATGAATGAATAAAAATAACATGG + Intergenic
1049042169 8:140120762-140120784 ATGAATGAATGGATGGATGTTGG - Intronic
1049118290 8:140709765-140709787 ATGAAGCAAAATATGGAACAGGG + Intronic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049480644 8:142820908-142820930 ATGAATGAATGGCTGAACCAAGG - Intergenic
1050063604 9:1735867-1735889 AAGAATGAATGAATGGAACAAGG + Intergenic
1050350292 9:4734765-4734787 ATGAATGGATAAATAAAACATGG + Intronic
1050875942 9:10636533-10636555 ATCAATGAAAAAATGGAATAAGG - Intergenic
1051261463 9:15269374-15269396 ATGAATGAATGAATGGAACCTGG + Intronic
1051802055 9:20946068-20946090 ATGAATGAATAAATAAAATATGG - Intronic
1052313198 9:27090734-27090756 ATGAATGAATATATAAAATATGG - Intergenic
1052456121 9:28700274-28700296 ATGAATGAATAGGTGGTATCGGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1053461134 9:38272360-38272382 TTGAAGGAATAGAGGGAACAAGG + Intergenic
1054727325 9:68665529-68665551 ATGAATGAATGCATGCTACATGG + Intergenic
1055777364 9:79780856-79780878 AGAAATGAATAGTTGCAACAAGG - Intergenic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057362074 9:94382505-94382527 GAGAATGAAAAGATGGACCACGG - Intronic
1057462437 9:95275351-95275373 AAGAGTGAATAGGTAGAACACGG + Intronic
1057661281 9:97005658-97005680 GAGAATGAAAAGATGGACCACGG + Intronic
1057977138 9:99617933-99617955 ATGGATAGATAGATAGAACATGG + Intergenic
1058780520 9:108329573-108329595 AAAAAAGAATAAATGGAACATGG + Intergenic
1058873755 9:109224304-109224326 ATGAATGGATAGACAGAACATGG + Intronic
1059365505 9:113783693-113783715 ATAGATGAATAGATGGATGATGG + Intergenic
1059485077 9:114620576-114620598 ATGAAATAAAATATGGAACAAGG + Intronic
1059583650 9:115580639-115580661 ATAGATAAATAGATAGAACAAGG - Intergenic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061911824 9:133729067-133729089 ATGAAGGAATAAATGGGAGAAGG + Intronic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062248010 9:135579607-135579629 AAGAATGGATGGATGGAAGATGG - Intergenic
1062458522 9:136652778-136652800 ATGAATGAATGAATGAACCATGG + Intergenic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1185481895 X:452689-452711 ATGATAGAATAGATGGATGATGG - Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185625072 X:1475307-1475329 ATGGATGAATAGATGATGCATGG + Intronic
1185840520 X:3385577-3385599 ATGAATGGATGGATGAAAGACGG + Intergenic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186150435 X:6669189-6669211 ATGAATGGATAGATTGATGATGG + Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186235246 X:7500998-7501020 ATGATGGCAAAGATGGAACAAGG + Intergenic
1187262335 X:17697448-17697470 ATGAAAGAATATATGAAGCAAGG + Intronic
1188170744 X:26921673-26921695 ATAAATATATAAATGGAACATGG - Intergenic
1189011528 X:37049953-37049975 CTAAAATAATAGATGGAACAAGG + Intergenic
1190365072 X:49685076-49685098 AGGGATGAATAGGTGGAGCATGG - Intergenic
1190827200 X:54028538-54028560 ATGAGTGCATAGAGGGCACATGG - Intronic
1191945460 X:66529967-66529989 AGGAATGAATAAATGAAATATGG - Intergenic
1192277358 X:69647679-69647701 ATGGCTGAATAGATGGAAGTGGG - Intronic
1192988532 X:76426954-76426976 GTGAATGAATAAAGGGATCAGGG + Intergenic
1193092909 X:77513362-77513384 ATGGATGACTAGATGCAGCAAGG + Intronic
1193581511 X:83269520-83269542 ATGAATGGATAAATGAAATATGG + Intergenic
1193620249 X:83744415-83744437 TTGACTGAATGGATGGAAAAGGG - Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1194462093 X:94183348-94183370 ACCAATAAATAAATGGAACAGGG - Intergenic
1194523870 X:94951884-94951906 ATAAATGAGAATATGGAACATGG - Intergenic
1195229159 X:102829068-102829090 ATAAAAGGATGGATGGAACAGGG - Intergenic
1195280235 X:103326276-103326298 ATGAATGAATAAATAAAGCATGG - Intergenic
1195649427 X:107269292-107269314 ATGAATGGATAAATGAAACTTGG + Intergenic
1195699426 X:107691473-107691495 AAGGATGAATAGGTGGAAAATGG - Intergenic
1196141841 X:112271481-112271503 ATTAATGAATAAATGAAACAAGG - Intergenic
1196974475 X:121143009-121143031 AAGAATGAATAGGTTGAGCATGG - Intergenic
1197274475 X:124462281-124462303 AGGAATCACTAGATGGAAGAAGG + Intronic
1197659126 X:129150716-129150738 ATGAATGAATGCATAAAACAAGG - Intergenic
1197860830 X:130968400-130968422 ATGAATGAATACATGAAATCTGG + Intergenic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1198796562 X:140402862-140402884 ATGAATGGATAAATAAAACATGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199052369 X:143252015-143252037 AAGAAGGAATGAATGGAACAAGG + Intergenic
1199111723 X:143943255-143943277 ATGATTTAATAGCTGGTACAAGG + Intergenic
1199595727 X:149504690-149504712 ATGAATGGATAGAAGGTAAAAGG + Intronic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1199664041 X:150082575-150082597 GTGACTGAATAGATGGATGAGGG + Intergenic
1199965259 X:152814684-152814706 ATGAATGAAAAGAGAGAACATGG - Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1200781624 Y:7221469-7221491 ATGTATGAATAGATGTAAAATGG + Intergenic
1200781877 Y:7224108-7224130 ATGAATATAAACATGGAACATGG - Intergenic
1201235489 Y:11906555-11906577 ATGAATGAATGGATGAAAGATGG - Intergenic
1202359980 Y:24097365-24097387 AGGAAGGAATAGAAGAAACAAGG + Intergenic
1202510797 Y:25572749-25572771 AGGAAGGAATAGAAGAAACAAGG - Intergenic