ID: 921503584

View in Genome Browser
Species Human (GRCh38)
Location 1:215938394-215938416
Sequence TGGGCTCCTCAATATGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921503574_921503584 26 Left 921503574 1:215938345-215938367 CCATTTCACTCTCACTGTCTTTC 0: 1
1: 1
2: 8
3: 248
4: 2171
Right 921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
921503578_921503584 -4 Left 921503578 1:215938375-215938397 CCTTTGAACTTTAGGAATTTGGG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
921503573_921503584 29 Left 921503573 1:215938342-215938364 CCTCCATTTCACTCTCACTGTCT 0: 1
1: 0
2: 2
3: 76
4: 920
Right 921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
921503575_921503584 4 Left 921503575 1:215938367-215938389 CCTTTCTTCCTTTGAACTTTAGG 0: 1
1: 0
2: 2
3: 50
4: 543
Right 921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921503584 Original CRISPR TGGGCTCCTCAATATGGGCG GGG Intronic
902121932 1:14173669-14173691 TAGGCTCCTCAAGTTGGGCGGGG - Intergenic
905724491 1:40238866-40238888 TAGGCTCTTCAATATGGTCTAGG - Exonic
905734755 1:40317303-40317325 GGGGCTCCTGAATATGCGGGGGG + Intronic
905769015 1:40625474-40625496 TGGGATCCTCAACAGTGGCGGGG + Exonic
905942073 1:41871855-41871877 TGGGCTCATCAATGTGGCCAAGG - Intronic
908457720 1:64320651-64320673 TGGATTACTCAATCTGGGCGCGG + Intergenic
916762454 1:167829498-167829520 TGGTGTCCTCACTATGGGCCTGG + Intronic
921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG + Intronic
1078488051 11:11742233-11742255 TGGGGTCATCAGTAAGGGCGGGG - Intergenic
1090956966 11:131521718-131521740 TGTGATCCTCAGTATGGGAGGGG - Intronic
1096321113 12:50613730-50613752 AGGGCTTCTCAACATGGGCTGGG - Intronic
1117501471 14:56356825-56356847 TGGGCTCCTTAAAGGGGGCGGGG + Intergenic
1118319367 14:64744040-64744062 TGGGCTCCTCCATCTGGCTGTGG - Exonic
1119945247 14:78686544-78686566 TGGGTTTCTCAATATGAGGGAGG - Intronic
1122703439 14:103605575-103605597 GGTGCTCCTCAATCTGGGTGTGG - Intronic
1131258349 15:90875896-90875918 TGGGTTCCTCAACCTGGGCCAGG + Exonic
1136276602 16:29182607-29182629 TGGGCTCCTCCCTCTGGGCTTGG + Intergenic
1140137413 16:72219534-72219556 GGAGCTGCTCAATGTGGGCGGGG + Intergenic
1142080986 16:88148668-88148690 TGGGCTCCTCCCTCTGGGCTTGG + Intergenic
1142138849 16:88463647-88463669 TGAGCTCCTAGATCTGGGCGGGG + Intronic
1143411242 17:6710572-6710594 TGGGCTTCTAAATAGTGGCGCGG - Intronic
1154165752 18:12013219-12013241 TGGGCTCCTCCCCATGGGAGTGG + Intronic
1158208003 18:55015071-55015093 TGGGCTCCTCAATCAGGGTAGGG + Intergenic
1160870856 19:1277216-1277238 TGGGGTCCTCAGTGTTGGCGAGG - Exonic
1163488905 19:17605737-17605759 TGGCCTCCTCCATAGGGACGAGG + Exonic
1165781116 19:38434762-38434784 TGGGGTCGTAAATATGGGAGGGG + Intronic
1165854300 19:38870576-38870598 TGGGCTCCCCAAGAAGGACGAGG - Exonic
930983331 2:57554748-57554770 TCGTCTTCTCAATATGGGCAGGG - Intergenic
935311277 2:101786183-101786205 TAGGCTCCTCTCTATGGGCCAGG + Intronic
944889801 2:204105560-204105582 TGGGCTCCACAATCTGGCCAGGG - Intergenic
947618545 2:231574152-231574174 TGCCCTCCTCAAGGTGGGCGTGG + Intergenic
1179176678 21:39012578-39012600 AGGGCACCTCAAGATGGGAGGGG + Intergenic
1180068919 21:45426486-45426508 TGGGCTTCTCCATCTCGGCGAGG - Intronic
1182636084 22:31728118-31728140 TGGGCTCCTGAATATGGATGAGG + Intronic
1185209850 22:49564730-49564752 TGGGCTCCTGAATCGGGGCCAGG - Intronic
950101354 3:10358804-10358826 TGGGCTCCGCACTATCTGCGTGG - Exonic
954073149 3:48157973-48157995 TGGGCTCCACAGGATGGGGGAGG - Exonic
956588009 3:70884418-70884440 TGGGCTCCTGGTTATGGGCCAGG + Intergenic
957219181 3:77360255-77360277 TGGGCTTCTAAATTTGGGGGGGG - Intronic
958960726 3:100507079-100507101 TGAGCTCCACAATATGAGCCTGG + Intronic
962621623 3:137185969-137185991 TGGGCTGCTCATTATGAGAGGGG - Intergenic
976368982 4:84265413-84265435 TGGGCACCCCAAAATGGGGGAGG + Intergenic
985659633 5:1150432-1150454 TGGGGTCCTCACTGTGGGCTGGG - Intergenic
990943944 5:61230535-61230557 TGGGATCCTCATGATGGGAGTGG + Intergenic
994844072 5:104963059-104963081 GGGGCTCCTCAAGGTGGGAGAGG - Intergenic
998273787 5:140732299-140732321 TGGGCTCCTCAATATAGTATAGG + Intergenic
1001676279 5:173519234-173519256 TGGGCTCTTCAATAGGGAAGGGG + Intergenic
1007504821 6:42327493-42327515 TGGGGTCCTCATTATGGACTAGG - Intronic
1017294503 6:152778157-152778179 TGGGGTCCTCATGATGGGCTGGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1032986238 7:137340696-137340718 TGGGCTTCTCCATAAGGGTGAGG - Intronic
1037734481 8:21555497-21555519 TGGGCTCCTCTGTGTGGGAGGGG - Intergenic
1044726463 8:95198316-95198338 TGGCATGCTTAATATGGGCGAGG - Intergenic
1049710782 8:144062427-144062449 GGGGCTCCTGCATGTGGGCGTGG - Intronic
1053093339 9:35300736-35300758 TGGGCTCCTCAATAGAGGAAGGG - Intronic
1055248497 9:74275844-74275866 TGGGCTCCTCAGTGTAGGGGGGG - Intergenic
1061042503 9:128148299-128148321 TGGGATCCCCAATCTGGGCTTGG - Intergenic
1062071485 9:134557471-134557493 TGGGCTCCTCGTTCTTGGCGAGG + Intergenic
1186927489 X:14351327-14351349 TGGGCTTCTCAATATGACCTTGG + Intergenic
1199783177 X:151082035-151082057 TGAGCTCCTCCATGGGGGCGGGG - Intergenic