ID: 921504022

View in Genome Browser
Species Human (GRCh38)
Location 1:215944154-215944176
Sequence AATAGGCAGCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 1, 2: 16, 3: 114, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921504022_921504024 -9 Left 921504022 1:215944154-215944176 CCAAATTTGGCCAGCTGCCTATT 0: 1
1: 1
2: 16
3: 114
4: 414
Right 921504024 1:215944168-215944190 CTGCCTATTTTTGTAAATAAAGG 0: 2
1: 6
2: 18
3: 40
4: 415
921504022_921504026 23 Left 921504022 1:215944154-215944176 CCAAATTTGGCCAGCTGCCTATT 0: 1
1: 1
2: 16
3: 114
4: 414
Right 921504026 1:215944200-215944222 ACAAAAGTAATTATCTTTCTAGG 0: 1
1: 0
2: 4
3: 44
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921504022 Original CRISPR AATAGGCAGCTGGCCAAATT TGG (reversed) Intronic
901121594 1:6898849-6898871 AACAGGTAGCTGGCCAACATGGG + Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
901453613 1:9351107-9351129 AATAGACAGTGGGCCAGATTTGG - Intronic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
902821364 1:18945312-18945334 AATAGGCAGAAGGCCATCTTGGG - Intronic
903061007 1:20668728-20668750 AATAGCCTGCAGGCCAGATTTGG - Intronic
903584196 1:24396616-24396638 AATAGGCAGTGGGTCAGATTTGG + Intronic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
903781343 1:25821806-25821828 ATTAGGCAGGTGGCCAGATGAGG - Intronic
904244563 1:29177863-29177885 AATAGGAAGATGACCAAATAAGG - Intronic
904720341 1:32502938-32502960 AATAGGCAGTGAGCCAAGTTTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905497211 1:38401695-38401717 AAGAGGCAGCAGGTCAGATTTGG - Intergenic
906096156 1:43225465-43225487 AATAGACAGCAGGCCCAATGTGG + Intronic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908555068 1:65249385-65249407 AATAGGAAGCTGGCCCAATGTGG - Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
909986526 1:82167428-82167450 AACAGGTAGTGGGCCAAATTTGG - Intergenic
910341571 1:86194146-86194168 AAGAGGCAGTGGGACAAATTTGG - Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911408801 1:97475728-97475750 ACTAGGCTGGTGGCCAAATTTGG + Intronic
911519881 1:98916633-98916655 GATAGGCAGCAGATCAAATTTGG + Intronic
912406750 1:109445500-109445522 AATGGGCAAGTGGCCCAATTTGG + Intergenic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
913485690 1:119331083-119331105 AATAGGCAGCACGCCAGATTTGG + Intergenic
913536766 1:119780436-119780458 AATAGGGAGCTCTCCAAAGTTGG + Intergenic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
917648423 1:177051343-177051365 AACAGGCAGTGGGCCACATTTGG - Intronic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
918675491 1:187279774-187279796 AACAAGTAGCTGGCCACATTTGG + Intergenic
919208846 1:194453831-194453853 AATACCCAGGTGCCCAAATTGGG - Intergenic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921765615 1:218969978-218970000 AATAGACAGTAGTCCAAATTTGG - Intergenic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922424770 1:225482536-225482558 AAGAGGCAGCTGGTCAGAGTTGG - Intergenic
923311390 1:232738928-232738950 AATAGTCAGATGGCCAGATGTGG - Intergenic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923694947 1:236239262-236239284 AATAAGCAGCAGGCCAGATTTGG - Intronic
924590127 1:245395810-245395832 AATAGGCAAAGGGCAAAATTTGG + Intronic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1063890095 10:10620145-10620167 AACAGGTAGTGGGCCAAATTCGG - Intergenic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064797908 10:19034604-19034626 TATGGGCTGCAGGCCAAATTTGG - Intergenic
1064811345 10:19202294-19202316 ACTACTCTGCTGGCCAAATTTGG + Intronic
1065639304 10:27765736-27765758 AATAGGCAGTGAGCCAGATTGGG - Intergenic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1068066619 10:52140138-52140160 AATAAGCAGCTGACAGAATTTGG + Intronic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG + Intergenic
1068696161 10:59970050-59970072 AATAGACAACTGGCCAGATGCGG + Intergenic
1068834007 10:61532207-61532229 AATAAGCAGCAGGCCAGACTTGG + Intergenic
1069061226 10:63896509-63896531 AATAGGCAGTAGGCCACATTTGG - Intergenic
1070237175 10:74640765-74640787 AATAGGCAGCTAGCCAGATTTGG + Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1071974941 10:90945959-90945981 ATTAGGCAGTGGGCCAAATCTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073993766 10:109293080-109293102 AACAGGCAGTGGACCAAATTTGG - Intergenic
1074876150 10:117614839-117614861 AACAGGCAGCTGGAAAGATTTGG - Intergenic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1076110240 10:127854715-127854737 AAGAGGCAGTTGGCTAGATTTGG + Intergenic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1078910034 11:15722661-15722683 AATAGACAGCTGGGCAATATTGG - Intergenic
1080424191 11:32141140-32141162 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1083953532 11:65970219-65970241 AGTAGGCATCTGGCGAAATCAGG + Intronic
1086279215 11:85166431-85166453 AAAAGCCAGGTAGCCAAATTGGG - Intronic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1087073201 11:94102326-94102348 ATTAGGTAGCTGGTCAAATGTGG + Intronic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1089281360 11:117377000-117377022 AAGAGGCTGCTGGCCACATCAGG - Intronic
1090069671 11:123532637-123532659 CATAGCCAACAGGCCAAATTCGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092066981 12:5598781-5598803 CAAAGGCAGCTGGCCTAAGTTGG + Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1094554566 12:31485600-31485622 AACAGTCAGCTGGACAGATTTGG + Intronic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1096980061 12:55723516-55723538 TGTAGGCAGCTGGCCAGATCTGG - Exonic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1099055995 12:77841569-77841591 ACTGGGCACCAGGCCAAATTTGG - Intronic
1099126436 12:78764005-78764027 AATAGGCAGTGGGCCAAATTTGG + Intergenic
1099517875 12:83621307-83621329 AACAGGCAGTGGTCCAAATTTGG + Intergenic
1100471026 12:94893176-94893198 AATAGGCAACTGCCTGAATTTGG + Intergenic
1100746034 12:97646919-97646941 AGTAGGCTGCAGGCCAGATTTGG + Intergenic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1101427479 12:104599813-104599835 AATGGGCAGTGGGCCAGATTTGG - Intronic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1101844394 12:108350853-108350875 AACAGGCAGTGGGCCAAATCTGG - Intergenic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102788442 12:115623297-115623319 AATAGGCAGCGTGTCAAATTTGG - Intergenic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103048510 12:117759250-117759272 AACAGGTACCTGGCCCAATTTGG - Intronic
1103220608 12:119241448-119241470 AAGAGGCAGATGCCCAAATGAGG + Intergenic
1103403975 12:120661792-120661814 AATAGGCATCTGGACAGATAAGG - Intronic
1103729151 12:123014415-123014437 AAGAGGCAACTGGGCACATTGGG + Intronic
1104418349 12:128614387-128614409 AATAGGCAGCTGGCTGCATTTGG + Intronic
1107737047 13:43410254-43410276 ATTAGGCAGCTGGGGAAATGTGG + Intronic
1107746216 13:43512693-43512715 GATAGGCAGCAGGTCAAATATGG - Intronic
1108293199 13:48983557-48983579 ACTAGGCAGCAGACCAGATTTGG + Intronic
1108524265 13:51272525-51272547 AATAGGTGGCAGGCCAGATTTGG - Intronic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110444680 13:75565667-75565689 AAGAGGCAGTGGGCCAGATTTGG + Intronic
1110605747 13:77430117-77430139 AATAGGCATCCGACCAGATTTGG - Intergenic
1110762512 13:79245938-79245960 CATAGGCAGGAAGCCAAATTTGG + Intergenic
1111247622 13:85561549-85561571 AATACTCATCTGTCCAAATTTGG + Intergenic
1111364425 13:87223546-87223568 CATAGCCAGCAGGCCAAAGTGGG + Intergenic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1111731939 13:92087484-92087506 AATAGAGAGTTGGCAAAATTTGG - Intronic
1113571843 13:111363425-111363447 AGTAGGCGGTGGGCCAAATTTGG - Intergenic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114225988 14:20739309-20739331 AATATGCAGCTACCCAAATCAGG + Intronic
1114230320 14:20775675-20775697 AATATGCAGCTATCCAAATAAGG - Intergenic
1115229512 14:31144670-31144692 AATGGGGAGCAGGCCAGATTTGG + Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1115663353 14:35519393-35519415 AATAAGCTGCTGACCAAACTAGG + Intergenic
1116398891 14:44480855-44480877 CATAGGCAGCTGGCAAAATGAGG + Intergenic
1117225969 14:53659440-53659462 AATAGGAAGATGGCCTCATTGGG + Intergenic
1118079256 14:62339412-62339434 AAAAGGCAGGGGACCAAATTTGG - Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118427284 14:65679854-65679876 AATAGGTAGGGGGCTAAATTTGG - Intronic
1119187972 14:72657707-72657729 AATAAGCAGTTGGCCAGATTTGG - Intronic
1119914963 14:78390235-78390257 AATAGGTAGTGGGCCAAATTAGG - Intronic
1120435327 14:84474624-84474646 AATAGGTAGCAAGCAAAATTTGG - Intergenic
1120518262 14:85495464-85495486 AACAGGCAGTTGGCAGAATTTGG - Intergenic
1120614496 14:86686395-86686417 AATAAGCAGCAGGCCAGATTTGG - Intergenic
1120804290 14:88729380-88729402 AATAGGCAGCAGGCCTGGTTTGG - Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1123670426 15:22651221-22651243 AATAGAGAGTTGGCAAAATTTGG - Intergenic
1124526404 15:30457674-30457696 AATAGAGAGTTGGCAAAATTTGG - Intergenic
1124772250 15:32550010-32550032 AATAGAGAGTTGGCAAAATTTGG + Intergenic
1125276392 15:37996473-37996495 AAGAGGCAGCTGGTGAAACTTGG - Intergenic
1125635868 15:41188251-41188273 TATAGCCCGCTGGCCAAATCTGG - Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1128190906 15:65695480-65695502 AATAGGCTTCAGGGCAAATTTGG + Intronic
1128343631 15:66840118-66840140 AATAGGTGGCAGGCCAGATTTGG - Intergenic
1128795282 15:70462146-70462168 AATAGGCAGTGGGCCAGATTTGG - Intergenic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1129952745 15:79606515-79606537 AATAGGCAGCAGGCCCATTTTGG - Intergenic
1130107009 15:80936369-80936391 AATAGTCAGATGGCAAATTTTGG - Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1133142998 16:3761928-3761950 AGCAAGCAGCTGGCCACATTTGG - Intronic
1133608095 16:7407849-7407871 AATAGTCCGCAGGCCAGATTAGG - Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1135062416 16:19282286-19282308 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1135835032 16:25817507-25817529 AATAGGCAGCAAGCCATATTTGG + Intronic
1136042277 16:27589451-27589473 AATAAGTGGCTGGCCAGATTTGG + Intronic
1136388192 16:29943648-29943670 ACTTGGCAGCTGGCCAAGTTAGG - Intronic
1137845910 16:51687909-51687931 AATAGGCAGCTGGCCGGGTTTGG - Intergenic
1138057941 16:53856038-53856060 AATAGACAGGTGGCCAAAGAGGG - Intronic
1138814474 16:60188421-60188443 AATAGGCTGCTGGCTACATCTGG + Intergenic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1140325486 16:73997526-73997548 AATAGGCACTGGTCCAAATTTGG + Intergenic
1140675324 16:77322859-77322881 TATGGGCTGCTGGCCAAATCTGG - Intronic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1141019407 16:80480794-80480816 AATAGGCAATGGGCCAGATTTGG + Intergenic
1141247661 16:82325073-82325095 AATAGGCAGCAGGACAGATCTGG + Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1148649589 17:49240097-49240119 CATAGTCAGATGGCCAAATTAGG - Intergenic
1148787047 17:50150563-50150585 AACAGGCGGCTGGCCAAGTCGGG + Exonic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1149281547 17:55110749-55110771 AATAGGCGGCAGTCCAGATTTGG + Intronic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150056931 17:62025703-62025725 AACAGGCAGTGGGCCAAATATGG + Intronic
1150175682 17:63052973-63052995 AATAGGTGGCAGGCCAGATTTGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1151142096 17:72003432-72003454 AACAGGCTGCGGGCCTAATTTGG + Intergenic
1151669968 17:75566625-75566647 AATAGGCAGGAGGCCAGATTTGG + Intronic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1155087897 18:22475413-22475435 AGTAGGCAACAGGCCATATTTGG - Intergenic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1158011878 18:52737978-52738000 AACAGGCAGAGGGCCAAAGTTGG - Intronic
1158471373 18:57739990-57740012 AATAGGTAGTGGGCCGAATTTGG - Intronic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1161978218 19:7617711-7617733 AATGGTCAGCTGGCCAAGTCAGG - Intronic
1162882585 19:13671085-13671107 AACAGGCAGCCAACCAAATTTGG + Intergenic
1162905687 19:13822321-13822343 AACAGGTGGTTGGCCAAATTAGG - Intronic
1164692201 19:30219842-30219864 AATAGGCATATGGCCTAAGTTGG - Intergenic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1166320061 19:42012132-42012154 AATAGACAGCAGGTCAGATTTGG - Intronic
1166780371 19:45339227-45339249 AATAGTAAGCTGGCCAAAGCTGG - Intronic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
925438044 2:3858395-3858417 AATAGGCAGCTGGCTTTATTTGG + Intergenic
925623573 2:5819169-5819191 AATAGGCAGCTGGTCAGTTTTGG + Intergenic
926254973 2:11185436-11185458 AATAGCCACCTGGCCAGATGCGG + Intronic
928120305 2:28579172-28579194 AAGAGGGAGCTCTCCAAATTTGG - Intronic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
929080489 2:38117466-38117488 AATAGGCATATGGACCAATTAGG - Intergenic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929352725 2:40979109-40979131 AATAGGCATCTGACAACATTCGG - Intergenic
930022568 2:47010344-47010366 AATAGGCAGAGGGCCAGATTTGG + Intronic
930165213 2:48197541-48197563 AATAGGCAATGGGCCAGATTTGG - Intergenic
931765617 2:65453416-65453438 AATAAGCAGCTGGCTAGATCCGG - Intergenic
932429293 2:71664383-71664405 AACAGGCTGCTGTCCAAGTTTGG + Exonic
932808621 2:74805345-74805367 ACTGGGGAGCTAGCCAAATTGGG - Intergenic
932848153 2:75155900-75155922 AATAGGCAGCAGGCCAGCTTTGG - Intronic
933102439 2:78277095-78277117 GAGGGGCAGCTGGCCAAGTTAGG - Intergenic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933396202 2:81734368-81734390 AATAGTCAGTGGGCCAGATTTGG + Intergenic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
934544294 2:95201841-95201863 AATTGGGAGCTGACCACATTTGG + Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934757016 2:96831492-96831514 AATAGGCTGCTAGCCAGATGTGG - Intronic
935651872 2:105389122-105389144 AATATGCAGCTGGACACATGCGG + Intronic
935696953 2:105778371-105778393 AGTGGGCAGCTGACCAAACTGGG - Intronic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
937636342 2:124159454-124159476 AATAGGTGGCAGGCCAGATTTGG + Intronic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
938837763 2:135124771-135124793 AATAGGCTAATGGCCAGATTTGG - Intronic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939659513 2:144870789-144870811 AATAGTCAGTGGGCCAGATTTGG + Intergenic
939734032 2:145821053-145821075 AATAGGCAGCAGTCAAGATTTGG - Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
942619400 2:177831531-177831553 CATAGGAAGCTTGCCAATTTGGG - Intronic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
945263714 2:207869425-207869447 AAAAGGCAGATGTCCAAAATAGG + Intronic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
946226717 2:218267786-218267808 AATAGGGAGCTTGGCAAATATGG - Intronic
946336922 2:219043817-219043839 AAAAGGCAGGTGGGAAAATTGGG + Intergenic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
948049046 2:234965642-234965664 AATTGGCTGCTTGCTAAATTGGG + Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169104018 20:2978844-2978866 AACAGGCAGTGGGCTAAATTTGG + Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170108135 20:12774383-12774405 AATAGGCTGCAGGCCAGATATGG + Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1172568363 20:35949501-35949523 AATGGCCAGTTGGCAAAATTAGG - Exonic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173454865 20:43193764-43193786 AATAGGCAGTGGTCCAGATTTGG - Intergenic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1174543732 20:51309289-51309311 AACAGGCAGTGGGCCATATTTGG - Intergenic
1174749070 20:53094042-53094064 AAAAGGCGGAGGGCCAAATTTGG - Intronic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1175779731 20:61674856-61674878 AATAGGCAGGGGGCCAGACTTGG - Intronic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178618090 21:34151569-34151591 AATAGGCAAGTGGACAAACTGGG - Intergenic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1179943873 21:44657506-44657528 AACAGGCAGTGGGCCAAATGTGG + Intronic
1180911692 22:19455343-19455365 AATAGGCAGATCACCAAATAGGG + Intronic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182294749 22:29306444-29306466 AGTAGGCAGATGGCCAAAGCCGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949168991 3:976232-976254 AACAGGCGGCCTGCCAAATTTGG + Intergenic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951603592 3:24405277-24405299 AATAGGAAGTGGTCCAAATTTGG - Intronic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951883378 3:27501155-27501177 AACAGGCAGCTGGTCAGTTTTGG - Intergenic
952095643 3:29949434-29949456 AATAGGCAGCAAGCAGAATTTGG + Intronic
952109194 3:30103271-30103293 AATAGGCAGTGGACCAAATTTGG - Intergenic
952147907 3:30553485-30553507 AATAGGCAAAGGGCCAGATTTGG + Intergenic
953146765 3:40284012-40284034 AAAAGGCACCTGGCCCAAATAGG - Intergenic
953798454 3:46003083-46003105 AGAAGGCAGCTGGCCAAAGAGGG + Intergenic
954039487 3:47874047-47874069 AAGAGGCCACTGGCCAAATCTGG + Intronic
954121537 3:48503073-48503095 GGTGGGCAGCTGGCCAAACTGGG - Intronic
954407589 3:50354142-50354164 AATGGGCAGCTGGGCAAGATGGG + Intronic
954975110 3:54686144-54686166 AATAGGCAGCAGGCCAGACTTGG - Intronic
955037930 3:55286946-55286968 AAAGGGCAGCAGGCCAGATTTGG + Intergenic
955499603 3:59570755-59570777 AATAGACCACAGGCCAAATTTGG - Intergenic
955511833 3:59688840-59688862 AACAGGCTGTGGGCCAAATTTGG + Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955690822 3:61589020-61589042 AATAGGCAGTGGGCCAGACTGGG - Intronic
955894642 3:63686351-63686373 AATAGGCAATGGGCCAGATTTGG + Intergenic
955956070 3:64291581-64291603 AATAGGCTGAGGGCCAGATTTGG + Intronic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956524008 3:70137336-70137358 AATAGGCAACAGGACAAATTTGG - Intergenic
956721175 3:72118875-72118897 CAGAGGCAGCAGGCCAGATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
957551116 3:81706213-81706235 AAAAGGCTGCAGGCCAAATCTGG - Intronic
957832072 3:85534485-85534507 AATAGGCAGTGGGCTAGATTTGG - Intronic
959279007 3:104313405-104313427 AAGAAGCAGATGGTCAAATTAGG + Intergenic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
959906989 3:111721207-111721229 AATAGGGAGCTGGGCCAATTAGG - Intronic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
960980838 3:123224204-123224226 AATAGTCAGCAGGCTAGATTTGG + Intronic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962225408 3:133602782-133602804 AATAGGCAGTGGGCCAGGTTTGG + Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
963287126 3:143444224-143444246 TCTAGGCATCTGGCCAATTTAGG - Intronic
963808304 3:149748767-149748789 AATAGGTAGCAAGCCAGATTTGG + Intronic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
964441964 3:156721069-156721091 GATAGGCAGCAGGCCAGATTTGG + Intergenic
965922962 3:173941834-173941856 AATAGGGAAATGGCCAAAATGGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
967654660 3:192032578-192032600 AACAGGCAGTGGGCTAAATTTGG - Intergenic
970509567 4:16767839-16767861 ATTAGGCTGCTGGTGAAATTTGG - Intronic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
970854867 4:20639463-20639485 AATAGGCAGCAAGCTAAATTTGG + Intergenic
972124715 4:35748932-35748954 AATGGGCAGCTAGCCAGATTTGG - Intergenic
974449490 4:62034189-62034211 AAAAGGCAGCTGGATGAATTTGG - Intronic
974870995 4:67641680-67641702 AATAGGCAGCATGCCTAATTAGG - Intronic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976664895 4:87579895-87579917 AAGAGAAAGCTGGCTAAATTTGG - Intergenic
977184604 4:93921100-93921122 AGTAGGCAGCAGGCCAGAGTTGG + Intergenic
978750264 4:112238087-112238109 AATAGGCAGAGGGCCAGATTTGG + Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
980544634 4:134243937-134243959 AGTAGGCAGCAGACCAGATTTGG + Intergenic
981900445 4:149855808-149855830 AATAGGCAGCTGGATATATGAGG - Intergenic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
982091866 4:151886996-151887018 AGTAGGCAGCTGGCTGGATTGGG - Intergenic
982936548 4:161484916-161484938 ATTAGGCAGTGGGCCAAATTTGG - Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
986583257 5:9287622-9287644 TATAGTCAGCAGGCCAAATCAGG + Intronic
987285741 5:16454675-16454697 AACAGGCGGTTGGCCAGATTTGG - Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987421999 5:17731170-17731192 AATAGGTGGCAGGCCAGATTTGG + Intergenic
987787562 5:22521808-22521830 GATAGGCTGCTGGTCAAATCTGG - Intronic
989468703 5:41789292-41789314 AATAGGCAGTGGGCCAGATTTGG + Intronic
989962279 5:50430529-50430551 AATATGAAGCTGGGCAAACTTGG + Intronic
991345727 5:65665199-65665221 AAGAGGCAGCTGGGCAGATTTGG + Intronic
991686989 5:69190285-69190307 AATAGGCAGTTAGGCAGATTTGG - Intronic
992350659 5:75925455-75925477 TATAGGTAGCTGGCAGAATTAGG + Intergenic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992858238 5:80886123-80886145 AATGGGCAGTGGGCCAGATTTGG - Intergenic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
994877980 5:105450000-105450022 AAGAGTCAGCTAGCCACATTAGG - Intergenic
995086484 5:108116820-108116842 ACAAGGCTGCTGGCCAGATTGGG - Intronic
995881096 5:116845470-116845492 AATAGGGAGAAGGCCAAAGTGGG - Intergenic
997145812 5:131432056-131432078 AATAGGCTGTTGGCTAAATTTGG - Intronic
997904594 5:137803802-137803824 AATAGGAAAATGGCCAAATTTGG - Intergenic
998423734 5:142010143-142010165 TAAAGGCCGCAGGCCAAATTTGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
999383552 5:151138710-151138732 AATAGGCAGGTGGCCTCATCAGG + Exonic
1000306747 5:160001663-160001685 TTTAGGCAGGTGGCCAATTTTGG - Intergenic
1000618314 5:163455064-163455086 AACAGGTAGTGGGCCAAATTTGG + Intronic
1000653297 5:163844949-163844971 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1002114896 5:176952465-176952487 AATAGGCAGCTGACAGGATTTGG - Intronic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004606826 6:17202662-17202684 AATAGGCACCTCACCAAATGAGG - Intergenic
1004962912 6:20811983-20812005 TATAGCCAGCTTGCCAAATCTGG - Intronic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1007941697 6:45787602-45787624 AACAGGCCGCTGGCCAGATGTGG + Intergenic
1008759438 6:54836060-54836082 AATATGGAACTGGCTAAATTAGG - Intergenic
1008976452 6:57433021-57433043 AATAAGCAGCTGGCTATATTTGG - Intronic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1009535105 6:64872365-64872387 ATTAGGCAGCTTGCTAAATGTGG - Intronic
1009974424 6:70657893-70657915 ACTAGGCATGTGACCAAATTAGG - Intergenic
1010065854 6:71681714-71681736 AGCAAGCAGCTGGCCAGATTTGG + Intergenic
1010129621 6:72475629-72475651 AATAGGCAACAGAACAAATTTGG - Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010437344 6:75849138-75849160 AACAGGCAGTGGGTCAAATTTGG - Intronic
1010735044 6:79434762-79434784 AACAGGCAGCGGGCTGAATTTGG - Intergenic
1011812777 6:91152256-91152278 AATAGGCTGCAGGCTAGATTTGG + Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1016430555 6:143980905-143980927 AATAGGCAGTGGTCCAGATTTGG - Intronic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1017430000 6:154361617-154361639 AATAGGCAGCAAGCCAAAAGCGG + Intronic
1017440227 6:154457998-154458020 AACAGGCAGCTGGCAGGATTTGG - Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG + Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1018598244 6:165507583-165507605 AATAGGGATCTGGACAAATCTGG - Intronic
1018878770 6:167852859-167852881 AAACTGCAGCTGGACAAATTTGG - Intronic
1020332435 7:7033095-7033117 TGAAGGCAGCTGGCAAAATTCGG - Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021348250 7:19554903-19554925 AACAGGCAGCTGACTAGATTTGG - Intergenic
1021548551 7:21844079-21844101 AAGAGGTGGCAGGCCAAATTAGG - Intronic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1022270493 7:28802784-28802806 ATTAGGCAGCGGGCCAGATTTGG - Intronic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023654273 7:42404064-42404086 AATAGGCAGCAACCCAGATTTGG - Intergenic
1024410163 7:49031265-49031287 AAGAGGCAGTGGACCAAATTTGG + Intergenic
1024664237 7:51529889-51529911 TATAGCCAGCAGGCCAAATCTGG + Intergenic
1024988454 7:55215693-55215715 AATAGGCTGCTGACTAGATTTGG - Intronic
1026658944 7:72281945-72281967 AAAAGGCAGCTTACAAAATTAGG + Intronic
1026949264 7:74336681-74336703 AATAGGCAGCAGGACTGATTTGG - Intronic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1027846084 7:83377523-83377545 GATAGGCAGAGGGCCAGATTTGG + Intronic
1027928960 7:84506499-84506521 AATAGGCAGTAGGGCAAATTTGG + Intergenic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1028932920 7:96433747-96433769 AACAAGCAGTGGGCCAAATTTGG + Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030346686 7:108441762-108441784 AATTGGCGGCAGGCCAGATTTGG - Intronic
1031476561 7:122230202-122230224 AATAGACAGCTGGACAAATAAGG - Intergenic
1032028178 7:128460152-128460174 TGTAGGCTGCTGGCCAACTTAGG + Intergenic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036505789 8:9354440-9354462 AATAGACAGTGGGCCAAATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1038561944 8:28588443-28588465 AATAGGCTGTGGGCCAGATTGGG + Intergenic
1039104067 8:33971203-33971225 AATTAGGAGCTGGCCAAATCTGG + Intergenic
1039104068 8:33971216-33971238 AATAGGCTGCAGGCCAGATTTGG - Intergenic
1039265866 8:35823270-35823292 AACAGGTAGCTGGCTAGATTTGG + Intergenic
1039368481 8:36959324-36959346 TATAGGTAGCTGGCAAAGTTTGG - Intergenic
1040704635 8:50110826-50110848 AATTGGCCCCTGGCTAAATTGGG + Intronic
1040845071 8:51829399-51829421 AAAAAGCAGCTGGCCATGTTTGG + Intronic
1041123216 8:54608165-54608187 AAAAGGCAGATGGCCAAAATAGG - Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1043843081 8:85132254-85132276 AATAGGCAGTGGGCCATATTTGG - Intronic
1043851499 8:85221278-85221300 GACTGGCAGCTGGCCAAGTTAGG + Intronic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045181521 8:99788788-99788810 AATAGGCTACATGCCAAATTTGG + Intronic
1046262963 8:111794602-111794624 AATAGCCAGAAGGCCAAATAGGG + Intergenic
1046828427 8:118717409-118717431 AATACCAAGCTGGCCAACTTTGG + Intergenic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1046964497 8:120148892-120148914 AATAGGCAGTGGGCCAGATTTGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051158566 9:14179630-14179652 AATAGGCAGCTGACCAATTATGG + Intronic
1051195625 9:14560590-14560612 AATAGGCCACTGGCCAAACTTGG + Intergenic
1051486456 9:17613905-17613927 ACCAGGCAGCTTGCCAAATAAGG - Intronic
1051608720 9:18941494-18941516 AACAGGCTGCTGGCCAGATCTGG + Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052480266 9:29015555-29015577 AATAGACAGCAGGTCAGATTTGG + Intergenic
1052678955 9:31663515-31663537 TATAGCCTGTTGGCCAAATTTGG - Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1053512254 9:38697941-38697963 AATGGGTAGCTGGCCAGATTTGG - Intergenic
1055311643 9:74988803-74988825 AATAGGCTACAGGCCAAATTGGG + Intronic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1059534282 9:115066646-115066668 AATAAGCAGCTGGCCAGATGTGG - Intronic
1059662222 9:116413190-116413212 AATAGGCAGAGGTCCAGATTTGG - Intergenic
1059666377 9:116450139-116450161 AATAGGCAGTGGGCCAGATTTGG - Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186343039 X:8663380-8663402 AATAGGTAGCAGGGCAGATTTGG + Intronic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186520740 X:10204703-10204725 AATAGGTAGTGGGCCAGATTTGG + Intronic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1186902583 X:14073590-14073612 AATAGGCTGTGGGCCATATTTGG + Intergenic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188820047 X:34764195-34764217 AATAGGAAGCTGGAGAAATGGGG - Intergenic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1193340429 X:80342790-80342812 AATAAGCAGTTGTTCAAATTTGG + Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1195278539 X:103308146-103308168 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1195817230 X:108902395-108902417 AGAAGGCAGCTGGCAGAATTTGG + Intergenic
1196991833 X:121337843-121337865 ACTAGGCAGCAGGCAGAATTTGG - Intergenic
1199210574 X:145205321-145205343 AATAGGTCACTGGCCAGATTTGG + Intergenic
1202350426 Y:23984264-23984286 AAAAAGTAGCAGGCCAAATTAGG - Intergenic
1202520353 Y:25685857-25685879 AAAAAGTAGCAGGCCAAATTAGG + Intergenic