ID: 921505470

View in Genome Browser
Species Human (GRCh38)
Location 1:215963567-215963589
Sequence GTGCCTGCATATTTTAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921505470_921505472 -1 Left 921505470 1:215963567-215963589 CCTCCACTAAAATATGCAGGCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 921505472 1:215963589-215963611 CTCTGTTCTTTATTACCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 148
921505470_921505473 9 Left 921505470 1:215963567-215963589 CCTCCACTAAAATATGCAGGCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 921505473 1:215963599-215963621 TATTACCAGCAGGAGATAAATGG 0: 1
1: 0
2: 0
3: 20
4: 197
921505470_921505474 13 Left 921505470 1:215963567-215963589 CCTCCACTAAAATATGCAGGCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 921505474 1:215963603-215963625 ACCAGCAGGAGATAAATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921505470 Original CRISPR GTGCCTGCATATTTTAGTGG AGG (reversed) Intronic
900563678 1:3321500-3321522 GAGCCTGTATATTTGTGTGGGGG + Intronic
903787648 1:25871982-25872004 GAGCCTGCAGAGATTAGTGGAGG - Intergenic
907799851 1:57753740-57753762 CTTCTTTCATATTTTAGTGGTGG + Intronic
907966533 1:59336242-59336264 GTGCCTATATAATTTAATGGGGG - Intronic
918756093 1:188340560-188340582 GTGCATGCATCTTTTATTGTAGG + Intergenic
918814741 1:189168474-189168496 GTGCGTGCATCTTTTATTGCAGG - Intergenic
918839811 1:189519998-189520020 GTTCCTGTAAATTTTAGTGTGGG - Intergenic
921429630 1:215050499-215050521 GTTCATTCATATTTTAGTAGAGG + Intronic
921505470 1:215963567-215963589 GTGCCTGCATATTTTAGTGGAGG - Intronic
923089377 1:230727972-230727994 CTGCCTTCATATTTTTGAGGAGG - Intergenic
924295656 1:242585048-242585070 GTGCCTGCACATGTTAGGGAGGG - Intergenic
1063832012 10:9964050-9964072 GTCTCTGCATGTCTTAGTGGAGG + Intergenic
1067477115 10:46574427-46574449 GAGCCAGCATGTTTCAGTGGGGG + Intergenic
1067617624 10:47767354-47767376 GAGCCAGCATGTTTCAGTGGGGG - Intergenic
1073381648 10:103082336-103082358 GTGCCTGCCTTTTTTGTTGGAGG + Exonic
1073560202 10:104489731-104489753 GTGCATGCCTCTTTTAGTTGAGG - Intergenic
1074189273 10:111122173-111122195 GTGCCTGTAGAGTTTAGAGGAGG + Intergenic
1075827531 10:125371943-125371965 TTACCTGCATATTTTAATTGAGG - Intergenic
1079993979 11:27275745-27275767 GTGCTTGCATATTTAAGGTGGGG + Intergenic
1081327216 11:41759465-41759487 CAGCCTACATATTTAAGTGGTGG - Intergenic
1082725818 11:56735422-56735444 GAGCCTGCCTCTTTTAGTAGAGG - Intergenic
1083713402 11:64562250-64562272 GTGTCTGCATCCTTCAGTGGTGG + Exonic
1084528625 11:69713333-69713355 GTGTGTGCTTATTTTAGGGGAGG - Intergenic
1085722468 11:78924535-78924557 TTGCCTTCATTTTCTAGTGGAGG - Intronic
1086223776 11:84482921-84482943 TTGCCAAAATATTTTAGTGGAGG + Intronic
1086951592 11:92896256-92896278 GTTCCTGCATATATTGCTGGTGG + Exonic
1090497595 11:127229648-127229670 GTGCCTGCATATTTCTAGGGTGG - Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1093191831 12:16083669-16083691 ATGGCTGCATATTATAGTTGTGG + Intergenic
1093446685 12:19267669-19267691 GTGCCTGGCTATTTTTTTGGGGG - Intronic
1099890321 12:88581752-88581774 TCGACTGCATAATTTAGTGGGGG + Intergenic
1099968195 12:89473501-89473523 ATGCCTGGCTATTTTAGTGGAGG - Intronic
1099986652 12:89673385-89673407 GTGCTTTTATATTTAAGTGGTGG - Intronic
1100688712 12:97015081-97015103 TTACCTGCATACTTTAGTGGTGG - Intergenic
1101884923 12:108654395-108654417 GTTCCTGCATATTTTTCTGGGGG + Exonic
1106409820 13:29503623-29503645 GTGCTGACATATTTTAGTGAAGG + Exonic
1107550637 13:41471474-41471496 ATGCCTGGTTATTTTAGAGGAGG - Intergenic
1108449076 13:50542220-50542242 GTACCTGCATTTGTAAGTGGAGG + Intronic
1110601170 13:77375938-77375960 CTGCCTGTATATTCTAGTGGGGG - Intergenic
1113337199 13:109388235-109388257 ATGCCTGCATATTTTGTGGGAGG - Intergenic
1113565302 13:111316113-111316135 GTTCCAGCATATTTTTGTTGGGG + Intergenic
1114239212 14:20850646-20850668 GTGCCCTGATTTTTTAGTGGGGG - Intergenic
1117440878 14:55757945-55757967 GTGTCTTCCTATTTTAGAGGAGG + Intergenic
1118302807 14:64630396-64630418 GTATCTGCAGATTTTGGTGGAGG + Intergenic
1119090609 14:71777672-71777694 TTGGCTGCATATTTTAGAAGGGG - Intergenic
1120222099 14:81746061-81746083 GTGCCTGTAAAATTTAGTGAAGG - Intergenic
1121396976 14:93634051-93634073 GTGCGTGTATATTTTAGGGTAGG - Intronic
1123839009 15:24226895-24226917 GTGCCTTCGTATATTACTGGCGG - Intergenic
1123867628 15:24536795-24536817 GTGCCTTCGTATATTACTGGAGG - Intergenic
1125783289 15:42290980-42291002 GTGCATGTATATTTTAGGTGAGG - Intronic
1127527733 15:59810452-59810474 GAGCCTGCAAATTTTGGTGTTGG + Intergenic
1138840053 16:60490136-60490158 GTTGCTGAATATTCTAGTGGAGG + Intergenic
1139638698 16:68275238-68275260 CTGCTTGCATATGTAAGTGGGGG + Exonic
1144096746 17:11906746-11906768 GTTCCTGCATTAGTTAGTGGAGG - Intronic
1154329760 18:13420421-13420443 GTGCTGGCATCTTTTATTGGTGG - Intronic
1155872674 18:31046734-31046756 GAGTCTGAAGATTTTAGTGGAGG - Intergenic
1158284457 18:55863819-55863841 GTGCCTGCAGATTTCACTGAAGG + Intergenic
1161544055 19:4869030-4869052 GTGACTGCATTTTTTTGGGGGGG + Intergenic
925581919 2:5419518-5419540 GTGCCTGTAAATTTAAGTGTCGG - Intergenic
926964577 2:18396106-18396128 CTGCCTGCACAATTTAGTAGTGG + Intergenic
928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG + Intergenic
931766763 2:65463730-65463752 GTGCCTTTATATTTTAGTCAAGG - Intergenic
931827192 2:66013700-66013722 GTGCCTACAAATTTTTGAGGGGG + Intergenic
932603078 2:73143493-73143515 GTGCCTGCATGTGGGAGTGGGGG - Intronic
932746410 2:74337293-74337315 GTGCCTGCAGGTTATTGTGGAGG - Intronic
933534697 2:83557605-83557627 GTGCCTGCAGATGTCACTGGAGG + Intergenic
933820037 2:86102863-86102885 GGGCCTGAATTTTTTACTGGAGG + Intronic
935728853 2:106048024-106048046 GTGCCAAGATAATTTAGTGGGGG - Intergenic
938156935 2:128949634-128949656 GTGGCTGCATTTTTTTGTTGTGG - Intergenic
941129652 2:161630985-161631007 GTACTTTCATATTTTATTGGAGG - Intronic
942010999 2:171762204-171762226 GGGCCTGCAAATTTTAGGGGAGG - Intergenic
942108389 2:172656214-172656236 GAGCCTCCATATGATAGTGGCGG + Intergenic
943563698 2:189492822-189492844 GTGATTGCATATTTTTGTGATGG - Intergenic
946606698 2:221412710-221412732 GTTCCTGCATATTTTGAGGGGGG + Intergenic
1176141779 20:63548035-63548057 TTGCCTGCTTATTTAAGTGTTGG + Intronic
1179483939 21:41697395-41697417 GTGACTGCATATGTATGTGGCGG + Intergenic
1181614181 22:24040997-24041019 GTGCCTTCATTTTCCAGTGGTGG + Intronic
1184740662 22:46427231-46427253 GAGCCTGGTTCTTTTAGTGGAGG - Intronic
1184832546 22:46998175-46998197 GTGCTTTCATGTTTAAGTGGGGG + Intronic
951449699 3:22822831-22822853 GAGGCTGCATAGTTTATTGGGGG - Intergenic
951457267 3:22906856-22906878 CTGCTTGCATATTTTGGGGGTGG - Intergenic
952206430 3:31185289-31185311 GGACCTGGATATCTTAGTGGGGG - Intergenic
954604075 3:51895205-51895227 GTGCCTGCATCATTCAGTGCTGG - Exonic
959356381 3:105334733-105334755 GAGGCTGCATCATTTAGTGGGGG - Intergenic
959830546 3:110856625-110856647 GTACCTGCATATGTTATAGGTGG + Intergenic
959861605 3:111222436-111222458 ATGCTTTTATATTTTAGTGGGGG - Intronic
960831252 3:121851154-121851176 GTGCGTGCATATGTTATTTGAGG - Intronic
962048134 3:131783212-131783234 GTACTTGCTTATTATAGTGGAGG - Intronic
962151781 3:132901559-132901581 GTGCCTGCATATTCAAGAGAAGG + Intergenic
964534010 3:157699588-157699610 GTCCCTTCACATTTTAGTGTGGG - Intergenic
966130513 3:176633202-176633224 GTGCCTGCAAATGTTACAGGAGG - Intergenic
966383424 3:179367462-179367484 ATGCCTGCATTTCTTGGTGGAGG + Exonic
969069379 4:4522394-4522416 GTGCCTGCTTATGTTATTGTGGG + Intronic
969129340 4:4980099-4980121 GTAAATGCATATTTTAGTGTGGG - Intergenic
970371887 4:15416432-15416454 TTGCCTGCACTTTGTAGTGGAGG - Intronic
971002759 4:22341085-22341107 GTGCATGCATCTTTTATTGCAGG - Intergenic
971701396 4:29982317-29982339 GTGCCTGAATATTGTATTGCAGG - Intergenic
976998931 4:91470840-91470862 GTGCATACATAATTTTGTGGGGG - Intronic
978789706 4:112648363-112648385 GTGCTTCCATGTTTCAGTGGAGG - Intronic
981913641 4:150010479-150010501 GTGCTTGCATTTTTAAGTGGGGG - Intergenic
985088417 4:186339337-186339359 TTCCCTGCATATTCTACTGGAGG + Intergenic
987180569 5:15363515-15363537 GTGTCTGGATATTTTACTTGAGG + Intergenic
988402675 5:30781722-30781744 GTTGCTGCATATTTTAGGTGAGG + Intergenic
993817056 5:92562031-92562053 GTACCTCCTTATTTTGGTGGAGG - Intergenic
993951225 5:94178028-94178050 GATCCTGCATATTTTAGTTAGGG + Intronic
995245074 5:109925842-109925864 GTGCCTCCATATGTTAATGATGG + Intergenic
995916574 5:117253507-117253529 GTAGCAGCATATTTGAGTGGAGG - Intergenic
997643402 5:135464529-135464551 TTGTCTGCATTTTTTAGAGGAGG - Intergenic
1002086115 5:176776644-176776666 GAGCGAGCACATTTTAGTGGAGG - Intergenic
1004541123 6:16551136-16551158 GTTCCTACATATTTTACTGCAGG + Intronic
1005223246 6:23612504-23612526 GTGCCTTTATATTTTACTGTAGG - Intergenic
1011643613 6:89436928-89436950 GTGTCTGCATTATTTACTGGTGG + Intronic
1016637034 6:146304594-146304616 ATCCCTGCATTTTTTAGTGATGG + Exonic
1024675725 7:51636506-51636528 GTGCCTGCACCTCTCAGTGGAGG + Intergenic
1027615503 7:80418492-80418514 GTTTCTTCATAATTTAGTGGGGG - Intronic
1028888861 7:95964618-95964640 GTCTGTTCATATTTTAGTGGTGG - Intronic
1030456135 7:109776317-109776339 GGTCCTGCACATTTTTGTGGAGG - Intergenic
1031609865 7:123812807-123812829 TTGCCTTTATATTTTTGTGGGGG + Intergenic
1032605477 7:133346224-133346246 GTGCTTGCTGCTTTTAGTGGAGG + Intronic
1036591683 8:10174188-10174210 GTTCCTGGATATTTTGGTGAGGG + Intronic
1038828037 8:31028326-31028348 GTGCATGCATATGTTTGTGTTGG - Intronic
1044534197 8:93340814-93340836 CAGCATGCATCTTTTAGTGGTGG - Intergenic
1051912471 9:22170156-22170178 GTGCCTGCATGTGTGAGTTGAGG + Intergenic
1058035224 9:100245213-100245235 GTGCCTGACAATTTTATTGGGGG - Intronic
1060604656 9:124902911-124902933 ATGACTGCAAATTTTATTGGTGG + Intronic
1189363847 X:40372894-40372916 ATGCCTGCATATTTGTGTGTAGG + Intergenic
1190814164 X:53914121-53914143 GTGCCTGAAGATTTGGGTGGTGG + Intergenic
1194421932 X:93686171-93686193 GTGACTGCAGATTTTAGAGAAGG - Intronic
1196153774 X:112404997-112405019 GTGTCTGCATATGTCAGTGGAGG + Intergenic
1196889666 X:120279816-120279838 GTAGCTACATATTTTAGTGGAGG - Intronic
1200973406 Y:9180349-9180371 GTGCATGCATCTTTTATTGCAGG + Intergenic
1202137673 Y:21684162-21684184 GTGCATGCATCTTTTATTGCAGG - Intergenic