ID: 921506097

View in Genome Browser
Species Human (GRCh38)
Location 1:215972170-215972192
Sequence CAGTGGGAGGCACTGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921506088_921506097 15 Left 921506088 1:215972132-215972154 CCAACTCTCTTGCTTGTTGGCCT 0: 1
1: 0
2: 3
3: 18
4: 196
Right 921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG 0: 1
1: 1
2: 1
3: 50
4: 392
921506091_921506097 -5 Left 921506091 1:215972152-215972174 CCTTCTATTGGGTTTTGCCAGTG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG 0: 1
1: 1
2: 1
3: 50
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921506097 Original CRISPR CAGTGGGAGGCACTGTGAGG AGG Intronic
901448269 1:9321009-9321031 CAGTGGGAGTTGCTGTGCGGGGG + Intronic
903013027 1:20343822-20343844 CAGTGGGCGGGGCTGTGCGGAGG - Intronic
903293536 1:22329467-22329489 CAGTCGGAGGCTCTTGGAGGAGG - Intergenic
903763727 1:25718264-25718286 CGCTGGGACACACTGTGAGGAGG - Intronic
904708700 1:32412170-32412192 AAGTGGGAGGCCATGTGTGGTGG + Intergenic
904948112 1:34214178-34214200 CAGTGAGCAGCACTGGGAGGAGG + Intronic
905284180 1:36868476-36868498 CAGAGGGAGGGACTGTAGGGAGG + Intronic
905791221 1:40790793-40790815 GATTGGGGGTCACTGTGAGGAGG + Intronic
905799303 1:40833140-40833162 CAGTGGGTGGCACACGGAGGGGG - Intronic
905908047 1:41632872-41632894 CAGTGGGAGGTGCTGTGTAGGGG + Intronic
905991471 1:42340882-42340904 CTGGGTGAGGCACTGTGAGAAGG + Intergenic
906124589 1:43419943-43419965 CGGTGAGAGGCACACTGAGGTGG + Exonic
906265350 1:44424708-44424730 CAGAGGGAGGCAATCCGAGGAGG - Intronic
906536085 1:46551681-46551703 CAATGAGAGGCAGGGTGAGGGGG + Intergenic
906795811 1:48695698-48695720 CAGTGAGAGGGACTCAGAGGAGG + Intronic
907454941 1:54569439-54569461 CCGTCGGAGGGACAGTGAGGGGG - Intronic
913195875 1:116455456-116455478 CCATGGGAGGCAGTGTGGGGTGG - Intergenic
913554155 1:119948435-119948457 CAGTGGTATGGACTGTGAGGAGG - Exonic
914191972 1:145419634-145419656 GAGTGGGAGCCAGTGCGAGGAGG - Intergenic
915288101 1:154865617-154865639 AAATGGGAGCCAATGTGAGGGGG - Intronic
915646383 1:157275713-157275735 CAGTTGGAGAAGCTGTGAGGGGG + Intergenic
915805458 1:158844161-158844183 CAGTGGAATGCACTGTGACTGGG - Intronic
916311789 1:163406411-163406433 CAGCGGGAGGCACTCTGTGTTGG + Intergenic
917343698 1:174006995-174007017 CATTGGGAGGGATAGTGAGGGGG - Intronic
917791376 1:178501318-178501340 CTGTGGGAGGCGCTGTGAACTGG + Intergenic
918102850 1:181391523-181391545 CAGTGGGAGGGGCTGTCTGGGGG + Intergenic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
919997566 1:202767357-202767379 CCGTAGGAGCCACTGTGAGGAGG - Intronic
920044250 1:203123377-203123399 CAGAGGGAGGCAGTGTTAGGTGG - Intronic
920841143 1:209554967-209554989 GAGTGTGAGGCAGTGTGAGAGGG - Intergenic
921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG + Intronic
921659840 1:217788591-217788613 CAGAGTGATGCAATGTGAGGAGG + Intronic
922249930 1:223839351-223839373 CAGTGTGAGGCACAGAAAGGGGG + Intronic
924243206 1:242059298-242059320 CAGTGATGGACACTGTGAGGCGG + Intergenic
1065040858 10:21694613-21694635 CAGTGGGAGCCCCTTTGAGCTGG + Intronic
1065534694 10:26705993-26706015 CAGCTGGAGTCACTGGGAGGTGG - Intronic
1065739136 10:28781193-28781215 CAGAGGAAGGAACTATGAGGAGG - Intergenic
1067065652 10:43102651-43102673 CAGTAGCAGGCACTGTGGGGCGG - Intronic
1070191106 10:74112676-74112698 CAGTGGGAGGGAATGGGAGTGGG + Intronic
1070416840 10:76198346-76198368 CAGTGGGCCGCACTTTGAGGAGG + Intronic
1071195484 10:83153962-83153984 CTGTGGCACGCCCTGTGAGGGGG + Intergenic
1071949124 10:90682822-90682844 CAGTGGAAGGCACTTGGGGGTGG + Intergenic
1072208027 10:93221613-93221635 CAGTGCTAGGGACTGGGAGGAGG - Intergenic
1073267201 10:102234881-102234903 CAGAGGGAGGCAGGGTGAGAAGG + Intronic
1073292159 10:102418799-102418821 TAGGGGGAGGGACTGAGAGGCGG - Exonic
1073673364 10:105617281-105617303 CAGGGTGACGCACTGTGAGAAGG + Intergenic
1073776830 10:106795803-106795825 CAGGGGGAGGCAGTGTGCCGTGG + Intronic
1074153234 10:110777114-110777136 AAGTGGGAGGCAGTGTGCTGAGG + Intronic
1074597009 10:114876799-114876821 GAGTGGGGTGCACTGTGGGGAGG - Intronic
1074700669 10:116089193-116089215 CAGTAGGAGGAGCCGTGAGGAGG - Intronic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1076432008 10:130410627-130410649 CAGAGAGATGCAGTGTGAGGAGG - Intergenic
1076783724 10:132738815-132738837 CAGTGAAAGGCACTGTCATGGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1078639531 11:13082087-13082109 CAGTGGGAGACAGTGAGAGCTGG + Intergenic
1078861225 11:15249109-15249131 CAATGGGAGGCACTGGAAGGAGG - Intergenic
1080934149 11:36844242-36844264 CAGTGTGATCCACTCTGAGGAGG + Intergenic
1081626588 11:44659641-44659663 GAGTGGGAGGTCCTCTGAGGAGG + Intergenic
1082799807 11:57406272-57406294 CAGTGGGAGGCAGGGGGATGGGG - Intronic
1082988483 11:59187389-59187411 CAGTTGGAGCCACTGTTGGGGGG + Intronic
1083292289 11:61696761-61696783 CAGCGGCAGGCACTGTCAGTGGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1084472025 11:69368128-69368150 GAGTGTGAGGCACACTGAGGGGG - Intergenic
1084938744 11:72601196-72601218 GAGTGAGGGGCTCTGTGAGGGGG - Intronic
1085205549 11:74730175-74730197 CAGTGTGAGACTCTGGGAGGCGG - Intronic
1085802593 11:79604303-79604325 CAGTGGGAGGCAACGACAGGAGG + Intergenic
1086079850 11:82891629-82891651 CAGTGGGAGGAACTGTAGGGAGG - Intronic
1087240403 11:95768636-95768658 CAGAGGGAGACACTCTGAGAAGG + Intergenic
1088321885 11:108563102-108563124 CAGAGGGAGGATCTGTGAGGAGG + Intronic
1088359814 11:108978349-108978371 AAGGGGGAGGCACTGGGATGAGG - Intergenic
1089008342 11:115112202-115112224 GAGTGGGTGGGTCTGTGAGGAGG - Intergenic
1089517127 11:119040239-119040261 CACTGGGAGGCACAGGCAGGAGG + Intergenic
1090616258 11:128518119-128518141 CTGTTGGAGGCACAGGGAGGGGG - Intronic
1091206185 11:133822937-133822959 CATTGGGAGGCATTGTCTGGAGG - Intergenic
1091365902 11:135020121-135020143 CAGTGGGAGGTACTGAGCTGAGG - Intergenic
1091448511 12:558573-558595 CATTCGGAAGCACTGTGTGGAGG + Exonic
1092212817 12:6658874-6658896 CAGTTTGAGGCAGTGCGAGGAGG - Intronic
1095628455 12:44345188-44345210 CAGTGGGACTCACTGTCAGAAGG + Intronic
1098443782 12:70545720-70545742 CTGTGAAAGGCACTGAGAGGAGG + Intronic
1100206214 12:92353070-92353092 AAATGTGAGGCAATGTGAGGAGG - Intergenic
1101493863 12:105235823-105235845 CGGTGGGAGGCGCCGCGAGGGGG + Intronic
1101496143 12:105256139-105256161 TCGTGGGAGGCACAGTGAGAAGG - Intronic
1103914877 12:124371043-124371065 GAGTGAGAGGCACAGTCAGGAGG - Intronic
1105243672 13:18628871-18628893 CAGGGGGAGGCGCTGGGAGTGGG + Intergenic
1105790140 13:23790588-23790610 GAGGGGGAGGCAATGTGATGAGG + Intronic
1106018447 13:25891680-25891702 CATTAGGGGGCTCTGTGAGGTGG + Intronic
1106780758 13:33056972-33056994 CAGTGGAATCCACTCTGAGGAGG - Intronic
1107688226 13:42925429-42925451 CATTGGTAAGCACTGTGTGGGGG + Intronic
1108310753 13:49187607-49187629 CCGTAGGAGCCACTGTGAGGAGG - Intronic
1112110418 13:96290884-96290906 CTGTGGGAGGAACAGTGAAGAGG - Intronic
1112133305 13:96548099-96548121 AGGTGGGAGGCACGGTGTGGGGG - Intronic
1113667882 13:112153578-112153600 CAGTGGCAGGCCCTGTCCGGGGG + Intergenic
1114618422 14:24080950-24080972 CAGTGCCAGGCACTGGGGGGTGG - Exonic
1117795842 14:59393713-59393735 CAGAGAGATGCACTGTGAGAAGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121025906 14:90616077-90616099 AAGTGGGAGGGAATGTGGGGAGG + Intronic
1122024219 14:98863402-98863424 GGGTAGGAGGCACTGGGAGGTGG - Intergenic
1123066158 14:105620437-105620459 CGGTGGGAAGCACGGTCAGGAGG - Intergenic
1123070302 14:105639490-105639512 CGGTGGGAAGCACGGTCAGGAGG - Intergenic
1123487623 15:20755760-20755782 CAGGGGGAGGCGCTGGGAGTGGG - Intergenic
1123544115 15:21324818-21324840 CAGGGGGAGGCGCTGGGAGTGGG - Intergenic
1124339485 15:28880838-28880860 CACCGGGAGGGCCTGTGAGGAGG - Intergenic
1124962524 15:34409551-34409573 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1124979148 15:34555773-34555795 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1125483338 15:40095340-40095362 CAGTGGGAGAAACAGTGAGGAGG + Intronic
1126117555 15:45222372-45222394 CAATGGGAAGCACTGGCAGGAGG - Intergenic
1126338185 15:47609860-47609882 CAGTGGCAGGCAGTGGGAGAGGG - Intronic
1126678410 15:51181711-51181733 CAGACGGAGGCAGTGAGAGGAGG + Intergenic
1127923741 15:63517554-63517576 CAGTGGGCTTCACTGTGAGGTGG + Intronic
1128249106 15:66152380-66152402 CAGTGAGAGGAAGGGTGAGGAGG - Intronic
1128735990 15:70054329-70054351 CTGTCTGAGGCACTGTGGGGTGG - Intronic
1129117780 15:73374853-73374875 GAGAGGGAGGCACTGGGAGGGGG + Intergenic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129702562 15:77776131-77776153 CAGGGGGAGGAGCTGGGAGGGGG - Intronic
1129783214 15:78288424-78288446 CAGTGGGAAGCTGAGTGAGGAGG - Intronic
1129902224 15:79159857-79159879 CACTGGAAGGCACTTTCAGGTGG - Intergenic
1129937667 15:79464114-79464136 CTGTGGGAGGTACAGTGTGGTGG + Intronic
1130865952 15:87933484-87933506 CAGCTGGAGGGGCTGTGAGGAGG + Intronic
1131133498 15:89914785-89914807 CAGTTGGAGCCACAGTGAGGGGG - Intergenic
1131456448 15:92585957-92585979 CTGTGGGAGGTTCTGTGAGCTGG + Intergenic
1132237452 15:100232776-100232798 CAGTGTGAAGAACTGTGAGGAGG - Intronic
1202952457 15_KI270727v1_random:52091-52113 CAGGGGGAGGCGCTGGGAGTGGG - Intergenic
1132501430 16:286224-286246 CAGGGGGAGGTTCTGTGTGGGGG - Intronic
1132841616 16:1980847-1980869 CAGTGGGAGTCACTGATGGGAGG + Exonic
1133223390 16:4328653-4328675 CAGTGGCAGGAAGTGTGTGGGGG + Intronic
1133598278 16:7313860-7313882 CACTGGCCGGCACAGTGAGGAGG - Intronic
1133686196 16:8167699-8167721 CAGTGGGGGCTACTGTGAGGAGG + Intergenic
1134246541 16:12544372-12544394 GAGTGGAAGGCGTTGTGAGGTGG + Intronic
1134599427 16:15521847-15521869 CAGTGGGAGGTACTAGGAGGTGG - Intronic
1136537531 16:30909072-30909094 CAGTGTGAGGCTCGGAGAGGAGG + Intergenic
1136932221 16:34429269-34429291 CAGTGGGAGGATGTGTTAGGGGG - Intergenic
1136972351 16:34982545-34982567 CAGTGGGAGGATGTGTTAGGGGG + Intergenic
1138096375 16:54215124-54215146 CAGGAGGAGGCACAGTGAGAAGG - Intergenic
1138295080 16:55878919-55878941 CAGTGGGAGGTGCAGTGATGGGG - Intronic
1138558428 16:57786321-57786343 CAGTGGGAGGCCTTTGGAGGAGG - Intronic
1138576020 16:57907839-57907861 CCCTGAGAGCCACTGTGAGGTGG - Intronic
1138588589 16:57986968-57986990 CAATGGGAGGGAGTGTGAGCCGG - Intronic
1138705694 16:58912847-58912869 CAGTGAGAGGAACAGTGGGGAGG - Intergenic
1139877913 16:70161166-70161188 CTTTGGGAGGCCCAGTGAGGTGG + Exonic
1140851504 16:78938900-78938922 GAGTGGGAGGCCCAGTCAGGGGG + Intronic
1141772122 16:86095920-86095942 TGGTGGGAGGCACTGGGAGGTGG - Intergenic
1141804622 16:86334633-86334655 CAGTGAAGGCCACTGTGAGGAGG + Intergenic
1141857631 16:86694662-86694684 CAGTGGGAGTGACTGTCATGGGG - Intergenic
1141942934 16:87290466-87290488 CAGTGGGAGACAAAGTGAGGTGG + Intronic
1142969970 17:3604702-3604724 CAGAGGCAGGCAGTGTGTGGCGG + Intergenic
1143323741 17:6084798-6084820 CACTGGGACCCACTCTGAGGCGG - Intronic
1143628254 17:8122966-8122988 CAGTGGGAAGCCCTGGGACGCGG + Intronic
1143734527 17:8901121-8901143 CAGTGGGAGGGAGTGTGGGAGGG + Intronic
1144321347 17:14123720-14123742 CAGTGTTAGGCAATGTGAGACGG + Intronic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1144753232 17:17664462-17664484 CTCTGGGAGTCACTCTGAGGAGG + Intergenic
1145915352 17:28570939-28570961 CAGTGACAGGCACCATGAGGCGG + Exonic
1146668752 17:34722489-34722511 CAGAGGGTGGCAAGGTGAGGAGG - Intergenic
1148792250 17:50180030-50180052 CAGTGGGAGGAACTGGGAAGGGG - Intergenic
1149451069 17:56750425-56750447 CAGTAGGAGGCATTGGCAGGAGG - Intergenic
1151278524 17:73054562-73054584 CAGTGGGAGGCCCAGGCAGGTGG + Intronic
1151983590 17:77528422-77528444 CAGGGGGAGGGAAGGTGAGGAGG - Intergenic
1152067555 17:78119933-78119955 CAGTAGGAGGCCCGGTGTGGTGG - Intronic
1152377926 17:79928281-79928303 GGGTGGGAGGCCCTGGGAGGTGG + Intergenic
1153475645 18:5495719-5495741 CGCAGGGAGGCACTGTGACGGGG + Intronic
1154445270 18:14431014-14431036 CAGGGGGAGGCGCTGGGAGTGGG - Intergenic
1155172939 18:23280631-23280653 AAGTGGTCAGCACTGTGAGGTGG - Intronic
1155356031 18:24955064-24955086 GAGTGGGCAGCACTTTGAGGAGG + Intergenic
1156200265 18:34822557-34822579 CAGTGGGACTCACTGTGAAATGG - Intronic
1156384125 18:36590909-36590931 CAGAGGGAGCCTCTGTGAGGTGG + Intronic
1157192525 18:45593338-45593360 CAATGTGAGGCAGTGTGAGCTGG + Intronic
1157419851 18:47537788-47537810 CTGGGAGAGGCACTGGGAGGTGG + Intergenic
1157539705 18:48491820-48491842 CAGTGGGAGGGACGGGGAGCAGG + Intergenic
1157586043 18:48801900-48801922 CTGTGGGAGGAACTGGGAGCTGG - Intronic
1157648589 18:49303650-49303672 CTGTGGGAAGCACTGTCATGTGG - Intronic
1157682895 18:49620761-49620783 GAGTGGGAGGAAGTGGGAGGAGG - Intergenic
1158358999 18:56651028-56651050 CAGTGGGAAGCAGTGTGATGGGG + Intronic
1158547117 18:58405825-58405847 CCGTGGGAGGCTCTGGCAGGTGG - Intergenic
1159034790 18:63266437-63266459 AAGTGGGAGGTAAAGTGAGGAGG + Intronic
1160011210 18:75108221-75108243 CAGTTCGAGGCAGCGTGAGGTGG + Intergenic
1160405085 18:78639808-78639830 CAGTGGCAGTCACTCTGAAGTGG - Intergenic
1160859674 19:1232350-1232372 CAGTGGGAGACCCTGTGTTGTGG - Intronic
1160916832 19:1500775-1500797 GAGTGGGAGGCACAGAGAGGAGG + Intergenic
1161075330 19:2282445-2282467 CAGTGGGGAGCCCTGTGAGATGG + Intronic
1161174808 19:2835183-2835205 GAGTGGGAGGCAGGGTGCGGTGG + Exonic
1161392658 19:4029230-4029252 CAGTGGGAGCTGCTGTGCGGAGG + Intronic
1161847218 19:6718804-6718826 CAGTGGGAGGGACTTAGAGGGGG + Intronic
1162514428 19:11139355-11139377 CTGTGGGAGGCCCAGGGAGGAGG - Intronic
1162850747 19:13429486-13429508 GAGTGAGGGGCACAGTGAGGGGG - Intronic
1163578874 19:18126317-18126339 CAGGGGGAGGCTCTGGGAGGAGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1163845350 19:19635414-19635436 CAGCGGGACGGAGTGTGAGGAGG - Exonic
1164299446 19:23948030-23948052 CAGTGGGAGGGACAGTGATCGGG + Intergenic
1164548790 19:29190676-29190698 CAGCGGGGTGCACTGTGTGGGGG + Intergenic
1166038021 19:40183332-40183354 CAGTCAGAGGCACTGGGAGTTGG + Intergenic
1166203005 19:41250845-41250867 CAGTGGGAGGCTGAGTGGGGAGG - Intronic
1167018900 19:46860352-46860374 CAATGGGAAGCAATGGGAGGTGG - Intergenic
925440546 2:3881553-3881575 CAGTGGGACCTAGTGTGAGGTGG + Intergenic
925531576 2:4868872-4868894 CAGTGAGAACTACTGTGAGGTGG + Intergenic
927203978 2:20595422-20595444 GAGCAGGAGTCACTGTGAGGAGG - Intronic
929389938 2:41458526-41458548 CAGTGGGAAGGAGTCTGAGGAGG + Intergenic
929647590 2:43643897-43643919 CAGGGAGAAGCACTGTAAGGGGG - Intronic
932132607 2:69201384-69201406 GAGTGGGAGGCACTGAGAGGAGG + Intronic
932133078 2:69204906-69204928 AAGTGGGAGGCAGCGAGAGGTGG - Intronic
933448334 2:82412006-82412028 TATTAGGAAGCACTGTGAGGCGG + Intergenic
934080166 2:88460761-88460783 CAGTGGGAGCCGCTGAGAGTTGG - Intergenic
934477287 2:94602131-94602153 AAGTGTGAGGGACTCTGAGGGGG + Intronic
934564702 2:95331838-95331860 CAGTGGGAGGCCCTGTGACTGGG + Intronic
934594777 2:95596135-95596157 AAGTTGTAGGCTCTGTGAGGTGG + Intronic
935118472 2:100158987-100159009 CAGTGGGAGTCAGTGGCAGGAGG - Intergenic
935371399 2:102350692-102350714 CAATGGGAGGCACTGGCAGGAGG + Intronic
935814547 2:106835013-106835035 CAGTGGGAGGCACAGGAAAGTGG + Intronic
937270619 2:120649147-120649169 CAGTAGGGGACACTTTGAGGTGG + Intergenic
937468140 2:122152748-122152770 GAGTGGGAGGCAGTGTGGAGAGG + Intergenic
938951249 2:136256697-136256719 CAGAGGAAGGCTCTGTTAGGAGG - Intergenic
940347081 2:152639036-152639058 CACAGGGAGGAACAGTGAGGTGG - Intronic
940478905 2:154203127-154203149 CAGTGTGAGGCATGGGGAGGAGG + Intronic
940900716 2:159124068-159124090 GAGTGGGAGGCCAGGTGAGGTGG + Intronic
943799109 2:192035427-192035449 CAGTGAGTAGCACTGTGAGTAGG + Intronic
944927795 2:204482719-204482741 CAGTGAGAGCCTCTCTGAGGTGG - Intergenic
945195654 2:207235160-207235182 CAGTGTGTGGCATTGGGAGGTGG - Intergenic
945335023 2:208581858-208581880 CAATGGGAAGCACTGATAGGAGG + Intronic
946326426 2:218986786-218986808 GAGTGGGAGGCAGAGTGTGGAGG + Intergenic
948670645 2:239566551-239566573 CTGTGGGAGGGTGTGTGAGGAGG + Intergenic
948768116 2:240233701-240233723 GAGGGGGAGGCACTGTGGGTGGG - Intergenic
948877861 2:240839741-240839763 CAGTGCCCCGCACTGTGAGGGGG + Intergenic
949045004 2:241868445-241868467 CAGTGGGACGCACTCTGGGAAGG - Intergenic
1170240872 20:14164840-14164862 CAGTGGGAGCAACTGTAAGCAGG + Intronic
1170751695 20:19154071-19154093 CAGTGGGAGGCACTGGCAGAAGG - Intergenic
1171187833 20:23136223-23136245 CAGAGGGTGTCAGTGTGAGGAGG + Intergenic
1172213105 20:33214699-33214721 AGGTGGGAGGTACTGTGAGAGGG - Intergenic
1172484217 20:35288687-35288709 CACTGGGGGGCACTGGGAGTGGG - Intronic
1172773389 20:37394105-37394127 CAGGGAGAAGCACTGTGAGTGGG + Intronic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1174092130 20:48058032-48058054 AAGAGGGAGGTGCTGTGAGGTGG - Intergenic
1175203231 20:57292136-57292158 CTGTGGGAGGTGATGTGAGGGGG + Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1175689342 20:61054388-61054410 CAGAGGGAGACACTGTGAGAGGG + Intergenic
1175814080 20:61874530-61874552 CAGAGGGAGGCCCTGGGCGGTGG + Intronic
1175969955 20:62680458-62680480 CATTGAGAGGCATTGAGAGGTGG - Intronic
1176045780 20:63091961-63091983 CTGTGGGGTGCTCTGTGAGGAGG - Intergenic
1176126428 20:63477401-63477423 CACTGGGAGGCACGGGGTGGTGG - Intergenic
1176245062 20:64093540-64093562 CAGTGTGTGGCAGTGTGTGGGGG + Intronic
1176450721 21:6858849-6858871 CAGGGGGAGGCGCTGGGAGTGGG + Intergenic
1176656535 21:9592818-9592840 CTGTGGGAACCACTGTGATGGGG + Intergenic
1176828890 21:13723867-13723889 CAGGGGGAGGCGCTGGGAGTGGG + Intergenic
1177088667 21:16739314-16739336 GACTGGGAGACACTGTGAGCAGG - Intergenic
1178723413 21:35030018-35030040 AAGAAGGAGGCAGTGTGAGGAGG - Intronic
1179167215 21:38944453-38944475 CAGTGGGTCTCACTGAGAGGTGG - Intergenic
1179622739 21:42628175-42628197 TAGTGGGAGGCAGTGGGATGAGG - Intergenic
1179648507 21:42791173-42791195 CAGTGGGAGGCTAAGGGAGGAGG + Intergenic
1179911052 21:44449076-44449098 CAGCTGGAGGCAATGTGAGGGGG - Intergenic
1179981934 21:44900224-44900246 CAGAAGGAGGCTCTGTCAGGTGG + Intronic
1179992778 21:44957298-44957320 CAGTGGGAGGCACTCTGAGGAGG - Intronic
1180004188 21:45012476-45012498 CAGTGAGAGGCCCTGAGACGGGG - Intergenic
1180699124 22:17772315-17772337 GAGTGGGAGGCCCTGTGGGGTGG + Intronic
1180784516 22:18539375-18539397 CAGTGAGAAGCCCTCTGAGGGGG + Intergenic
1180962321 22:19767506-19767528 CAGTGGGAGCCCCTATGGGGCGG - Intronic
1181011111 22:20041066-20041088 CAGGGGCAGGCACTGAGTGGGGG + Intronic
1181128093 22:20713428-20713450 CAGTGAGAAGCCCTCTGAGGGGG + Intronic
1181162474 22:20966611-20966633 CAGTGGGATGGACTGTGGGGAGG + Intronic
1181241419 22:21478732-21478754 CAGTGAGAAGCCCTCTGAGGGGG + Intergenic
1181646545 22:24234329-24234351 CACTGTGAGGGACTGAGAGGTGG - Intronic
1182234796 22:28866763-28866785 CAGAGGGAGACCCTGTTAGGAGG + Intergenic
1183739225 22:39660933-39660955 GAAGGGGAGGCACTGTGATGGGG + Intronic
1183946040 22:41326311-41326333 CTATGGGAGGAACAGTGAGGAGG - Intronic
1183946046 22:41326340-41326362 CTATGGGAGGAACAGTGAGGAGG - Intronic
1183946055 22:41326392-41326414 CTATGGGAGGAACAGTGAGGAGG - Intronic
1183946067 22:41326467-41326489 CTATGGGAGGAACAGTGAGGAGG - Intronic
1183946072 22:41326496-41326518 CTATGGGAGGAACAGTGAGGAGG - Intronic
1183946078 22:41326525-41326547 CTATGGGAGGAACAGTGAGGAGG - Intronic
1184277738 22:43419752-43419774 CAGAGAGAGGCACAGAGAGGTGG + Intronic
1184378708 22:44131643-44131665 CAGGGGGAGGGACTGTCTGGAGG + Intronic
1184409781 22:44319825-44319847 GAGTGGGATGCACTGTGCCGGGG + Intergenic
1185238447 22:49727841-49727863 CACTGGGAGCCACCGTGAGAGGG - Intergenic
949599279 3:5580793-5580815 CAATGGGAGGCACCCAGAGGAGG + Intergenic
949891675 3:8737912-8737934 AACTTGGAGGCACTGTGGGGTGG - Intronic
949922535 3:9014142-9014164 CAGTGGGGGCCCCTGAGAGGAGG + Intronic
950053064 3:10006639-10006661 CAGAGGGAGGGAATGGGAGGGGG + Intronic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
953836524 3:46350799-46350821 CACTGGGAAGCACTGGTAGGAGG + Intergenic
954748389 3:52799948-52799970 CAGAGGGAGGCACCGCTAGGAGG - Intronic
955060673 3:55489203-55489225 CAGTGTGAGGCACTGTTTGTGGG - Intronic
955878758 3:63521898-63521920 CAGTCGGAAGCACTGGCAGGAGG - Intronic
956774017 3:72550050-72550072 CAGGGGCAGGTACTGTGGGGAGG + Intergenic
959416037 3:106076860-106076882 CAGTGAGAGACAGTGTGTGGAGG + Intergenic
960400578 3:117192825-117192847 CAGTGTGATGCAATGTGAAGAGG + Intergenic
961457510 3:127031462-127031484 CAGCAGGATGCACGGTGAGGAGG - Intronic
961461726 3:127054361-127054383 GCCTGGGAGGGACTGTGAGGTGG + Intergenic
961501936 3:127342496-127342518 CAGTGGGAGGGGCTCTGGGGAGG + Intergenic
961508574 3:127387743-127387765 AGGTGGGTGGCACTGGGAGGGGG - Intergenic
961646884 3:128397452-128397474 GAGTGGGAGGCATTTGGAGGAGG + Intronic
962376786 3:134864879-134864901 CTGTGGGATGCACTGGGAGTTGG - Intronic
965385750 3:168044229-168044251 GAGGGGGAGGCACGGTGGGGTGG + Intronic
966928280 3:184659559-184659581 CATTTGGAGGAACTGTGCGGTGG + Intronic
967113095 3:186312590-186312612 CAGGGGGAGTCACTGAGACGAGG + Intronic
967841521 3:194008650-194008672 CTGTGGGAGGCACAGGCAGGCGG + Intergenic
968521503 4:1036597-1036619 CAGAGGGTGGGACTCTGAGGTGG - Intergenic
968870587 4:3240066-3240088 TGGTGGGAGAGACTGTGAGGCGG + Exonic
968883009 4:3310713-3310735 CAGCTGTGGGCACTGTGAGGTGG + Intronic
968930395 4:3575825-3575847 CAGTGGGTGGCAGTGACAGGAGG - Intergenic
968994801 4:3938666-3938688 CAGCGGGAGGCTCAGGGAGGAGG + Intergenic
969563545 4:7964540-7964562 CATGAGGAGGTACTGTGAGGAGG + Intergenic
969593836 4:8137066-8137088 CAGAGGGAGGCACGGAGAGTGGG - Intronic
971953118 4:33380185-33380207 CAGAGTGAGGCAATGTGAGAAGG + Intergenic
972656999 4:41073799-41073821 CAGCAGGAGGCCCAGTGAGGTGG + Intronic
972853816 4:43082040-43082062 CAGTGGGAGGGACAATGATGGGG + Intergenic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
982325490 4:154125058-154125080 CACAGGGAGGCACTGGGAGGAGG + Intergenic
984758700 4:183346072-183346094 CAGTGGCGGGCACTGTGGGAAGG - Intergenic
986799674 5:11246419-11246441 CAGAGAGAGGCAATGTGAAGAGG + Intronic
987079984 5:14417872-14417894 CAGTGCGAGGCAGGCTGAGGAGG + Intronic
987829629 5:23078234-23078256 CTGTGTGATGCACTGTAAGGTGG + Intergenic
987889914 5:23863915-23863937 CAGTCAGAGGCTCTGTCAGGGGG - Intergenic
988670038 5:33371442-33371464 CAATGGGAGGCACTGGATGGAGG + Intergenic
988708142 5:33745479-33745501 CTGTGGGAGGCATTCTAAGGTGG - Intronic
989270356 5:39526011-39526033 CAGTGGGAGGCACTGGCGTGGGG - Intergenic
993332524 5:86618097-86618119 CCGTAGGAGCCACTATGAGGAGG + Exonic
994030675 5:95138635-95138657 CAGTGGTGGTCTCTGTGAGGGGG - Intronic
996952433 5:129143563-129143585 GGGAGGGAGGCAATGTGAGGAGG - Intergenic
998049131 5:139016861-139016883 CAGAGTGAGGCCCTGTCAGGGGG - Intronic
999177035 5:149638949-149638971 CAATGGGAGGCACTGGCAGGTGG + Intergenic
1000293035 5:159889116-159889138 CAGTGTGAAGCACTGGTAGGAGG - Intergenic
1002819055 6:706833-706855 AAGTGGGAGGCCCTTTGAGCAGG - Intergenic
1005689173 6:28285324-28285346 CTGTGGGAGACATTTTGAGGTGG + Intronic
1006152946 6:31998979-31999001 CACAGGGAAGCATTGTGAGGAGG - Intronic
1006159254 6:32031716-32031738 CACAGGGAAGCATTGTGAGGAGG - Intronic
1006808754 6:36806309-36806331 CAGTGGGAGACACTGGTAGATGG + Intronic
1011160284 6:84381894-84381916 CAGGGGGAAGAACGGTGAGGGGG - Intergenic
1012249906 6:96968675-96968697 CAGTGGGAGAGTCTGAGAGGTGG - Intronic
1012986852 6:105884786-105884808 ATGTGGCAGGCACTTTGAGGAGG - Intergenic
1013937532 6:115616225-115616247 CAGAGGCAGGAATTGTGAGGAGG - Intergenic
1014138760 6:117917490-117917512 CAGTGGTTTGCACTGGGAGGTGG + Intronic
1015189899 6:130461093-130461115 CAGTGGGAGGAAGTGGCAGGTGG - Intergenic
1016398130 6:143648437-143648459 CACTGGGAGTCCCTGGGAGGGGG + Intronic
1017809095 6:157971350-157971372 CAGTGAGAGCCTCTTTGAGGTGG - Intergenic
1017992236 6:159501077-159501099 CTGGGGGAGGCAGTGTGAAGTGG - Intergenic
1018020939 6:159761936-159761958 CAGTGGGATGCGCGGGGAGGTGG + Exonic
1018030415 6:159837034-159837056 CAGTGGGATGCCCTGCGGGGAGG - Intergenic
1018579465 6:165296369-165296391 CATTTTGAGGCACTGGGAGGAGG - Intronic
1018818655 6:167355934-167355956 CATTGGGATACAGTGTGAGGAGG + Intronic
1020140272 7:5607895-5607917 GGGTGGGAGGCACTGGGAAGGGG + Intergenic
1020224446 7:6269086-6269108 CACTGGGAGCCACTGGCAGGAGG - Intronic
1023264793 7:38393520-38393542 CACTGGGTGGCACTTTGAGAAGG - Intronic
1023844662 7:44113919-44113941 GCGTGGGAGGCACAGTGTGGGGG - Exonic
1023973969 7:45014083-45014105 CAGTGGGAAGCACTTTAAGCTGG + Intronic
1024127697 7:46317504-46317526 CAGTGGGAAGCAGTGGGAAGCGG - Intergenic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1024946396 7:54811977-54811999 CAGTGGGAGGCCATGAGAGCCGG - Intergenic
1026346943 7:69482634-69482656 CAGTGGGAGGGACAGTGATCGGG + Intergenic
1026994371 7:74606184-74606206 CACTGGGAGCCACTAGGAGGTGG - Intergenic
1027001305 7:74656737-74656759 CAGTGGGTGGTACTGGGTGGGGG + Intergenic
1027267831 7:76503889-76503911 CAGTGGGAGGAACCCTGCGGAGG + Intronic
1027319642 7:77003751-77003773 CAGTGGGAGGAACCCTGCGGAGG + Intergenic
1028993366 7:97074611-97074633 CAGTGGGAGGGACAGTGATCAGG + Intergenic
1029435882 7:100563871-100563893 CAGTGGGTGGCACTGCCTGGGGG - Exonic
1029657566 7:101937054-101937076 CAGAGGGAGGCCATGGGAGGGGG - Intronic
1031144088 7:117978723-117978745 CAATGGGAGGCACTCGCAGGAGG + Intergenic
1031283289 7:119833128-119833150 CAGGGGGAGGCAGTATAAGGAGG - Intergenic
1034202178 7:149289580-149289602 CTGTGGGAGGCAGGGTGAGGAGG + Intronic
1034313753 7:150111555-150111577 CAGTGTGTGTCACTGTGAGTGGG - Intergenic
1034468870 7:151245435-151245457 GAGTGGGAGGCCCGGCGAGGAGG - Intronic
1035068368 7:156123942-156123964 CAGTGGGAGCCAGGGTGTGGGGG - Intergenic
1035407626 7:158609891-158609913 GTGTGTGAGGCAGTGTGAGGAGG + Intergenic
1035422008 7:158737526-158737548 GAGGGGTAGGCACTGTGGGGTGG - Intronic
1035458268 7:159023544-159023566 CAGCGGCGGGCATTGTGAGGTGG - Intergenic
1035546060 8:483256-483278 TGGTGGGAGGCCCTGTGAGGAGG - Intergenic
1035560639 8:601398-601420 CAGTGGAAGGCGCTGGGAGTGGG + Intergenic
1036442469 8:8793635-8793657 GAGTGGGAGGGACTGTGCTGAGG + Intronic
1036571451 8:9983242-9983264 CAGTGGGAGCCACAGTGGGCAGG + Intergenic
1037777662 8:21846509-21846531 CAGTCGGTGGCCCTGGGAGGAGG + Intergenic
1038169358 8:25114854-25114876 CAGTGGGAATCACTGTGCTGTGG + Intergenic
1038711188 8:29947543-29947565 CTGTGGAAGACCCTGTGAGGGGG - Intergenic
1038742267 8:30226057-30226079 CAGTGGGAGGAACAATGATGGGG - Intergenic
1039487881 8:37926221-37926243 CAGCGGGAGGCAGGCTGAGGTGG - Intergenic
1040395464 8:46995606-46995628 CTATGAGAGGCACTGTGGGGAGG - Intergenic
1043355539 8:79407840-79407862 CAGTGACAGACACTGTGAGCTGG - Intergenic
1043508839 8:80930347-80930369 CCGAGGGAGGCACTGGGAGTTGG + Intergenic
1044974259 8:97647833-97647855 CTTTGGGAGGCACTGTTGGGAGG + Intronic
1045316986 8:101052082-101052104 CAGTTGGAGGGGCTGTGAGCTGG - Intergenic
1045332849 8:101170591-101170613 CAGTGGAAGGCACTGTTAGATGG + Intergenic
1045566763 8:103324984-103325006 CAATGGCTGGCACTGTGTGGTGG + Exonic
1047557232 8:125945728-125945750 CAGGGTGAGGGACTGTGGGGTGG + Intergenic
1047960787 8:130010322-130010344 CAGAGGGTGGCACTGTGGAGCGG + Intronic
1048414788 8:134214326-134214348 CAGTGGGAGCCACTGCAAGTGGG + Intergenic
1048442150 8:134468080-134468102 CAGTGGGCAGCACAGTCAGGTGG - Intergenic
1048970936 8:139644718-139644740 CAGTGGGAGGCTCTGGGGGGGGG - Intronic
1049053689 8:140218670-140218692 CAGTGGGAGGCCAGGTGTGGTGG + Intronic
1049218713 8:141419133-141419155 CAGTGGGGGGTAGTGTGGGGTGG + Intronic
1049403185 8:142439997-142440019 CAGAGGGAGGCAGTCTCAGGAGG - Intergenic
1049607845 8:143537955-143537977 GAGTGTGAGGGGCTGTGAGGAGG - Intronic
1049673872 8:143881143-143881165 CAGTGAGACGCACAGCGAGGAGG - Intergenic
1049699673 8:144004504-144004526 CAGTGTGAGGTACCGGGAGGTGG - Intronic
1050060869 9:1708505-1708527 CAGTGTGAGGCATTAAGAGGTGG + Intergenic
1050091374 9:2017958-2017980 CAGCGGGAGGCACCATGAGGGGG + Intronic
1050364009 9:4857235-4857257 GAATGGGAGGCACTGTGAGCTGG - Intronic
1050991189 9:12154465-12154487 CAATGACAGGCACTGTGTGGTGG + Intergenic
1051075316 9:13226482-13226504 CACTTTGAGGCACAGTGAGGAGG - Intronic
1053289280 9:36869340-36869362 CAGTGGGAGGTGGAGTGAGGAGG - Intronic
1053680782 9:40483982-40484004 AAGTGTGAGGGACTCTGAGGGGG - Intergenic
1053930768 9:43112294-43112316 AAGTGTGAGGGACTCTGAGGGGG - Intergenic
1054282931 9:63140953-63140975 AAGTGTGAGGGACTCTGAGGGGG + Intergenic
1054293864 9:63319497-63319519 AAGTGTGAGGGACTCTGAGGGGG - Intergenic
1054391889 9:64623986-64624008 AAGTGTGAGGGACTCTGAGGGGG - Intergenic
1054459712 9:65456089-65456111 CAGTGGGTGGCAGTGACAGGAGG + Intergenic
1054503840 9:65892342-65892364 AAGTGTGAGGGACTCTGAGGGGG + Intronic
1054793862 9:69280560-69280582 CAGTGCAAGGCACTGGAAGGAGG + Intergenic
1055610809 9:78022085-78022107 CAGTGGGGAGCACTTTGAGGGGG - Intronic
1056827019 9:89883585-89883607 TGGAGGGAGGCACTGTGGGGGGG - Intergenic
1060321053 9:122561809-122561831 CAGTTGGTGGCACTGGGAGCAGG + Intergenic
1060355783 9:122905531-122905553 CTGTGGGAGGTACTGTGAGAAGG + Intergenic
1060855712 9:126914179-126914201 CTGTGCCAGGCACGGTGAGGTGG - Intergenic
1061370723 9:130195991-130196013 CAGTTGGAGGCTCTGGGAGGAGG + Intronic
1061402368 9:130375552-130375574 TGGTGGGAGCCACTGTGATGGGG - Intronic
1061632611 9:131882706-131882728 CTGAGGCAGGCAGTGTGAGGAGG - Intronic
1061883218 9:133578302-133578324 CAGAGGGAGGCACGGGGAGAGGG - Intergenic
1062063355 9:134511630-134511652 CAGTGGGAGACTTTGAGAGGAGG - Intergenic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1062339844 9:136089186-136089208 CAGGGGGAGGCTCTGGGTGGGGG - Intronic
1062428186 9:136515690-136515712 CACGGGGACGCACTGCGAGGTGG - Exonic
1203518461 Un_GL000213v1:25668-25690 CAGGGGGAGGCGCTGGGAGTGGG - Intergenic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1186871774 X:13781044-13781066 CAGTGGGAGGAAGTGGGAGGTGG - Intronic
1187398007 X:18934829-18934851 CATTAGGAGGCAGTGTGGGGTGG + Intronic
1188144291 X:26590535-26590557 CAGAGTGAAGCACTATGAGGGGG + Intergenic
1188649937 X:32620000-32620022 CAATGGGAGGCACTGGCAAGAGG - Intronic
1188803312 X:34558121-34558143 CAGTGGGAGGCACTTCTAGGAGG - Intergenic
1189302234 X:39960371-39960393 GAGTGGGAGGCACGGAGGGGAGG - Intergenic
1190630428 X:52380745-52380767 CAGTGTGAGTGAGTGTGAGGAGG + Intergenic
1190685417 X:52868473-52868495 AAGTGGGAGAGACTGTGAGGAGG - Intergenic
1190702109 X:52996821-52996843 ATGTGTGAGGCACAGTGAGGAGG + Intergenic
1190908056 X:54747463-54747485 CAGAGGGAGGCAGTGTAAGATGG - Intergenic
1191000858 X:55658357-55658379 AAGTGGGAGAGACTGTGAGGAGG - Intergenic
1193502580 X:82297767-82297789 CAGTGGGAGGCACTCTGGCAGGG - Intergenic
1194061833 X:89212943-89212965 CAGTAAGAGGTACTCTGAGGTGG - Intergenic
1194413329 X:93580708-93580730 CAGTTGGAGGCCCTCTGAGCTGG + Intergenic
1195626908 X:107013296-107013318 CAGTAGGAAGCACTCTGAGATGG - Intergenic
1196173349 X:112614079-112614101 TAGTGTGGGGCACTGTGTGGTGG + Intergenic
1197916804 X:131544396-131544418 CAGTAGGAGGCACTCTGCTGTGG - Exonic
1198557644 X:137812255-137812277 CAATGGGAGGCACTGGCAAGAGG - Intergenic
1199872540 X:151912516-151912538 CAGGCGCAGGCTCTGTGAGGAGG + Intronic
1200075605 X:153549161-153549183 CACTGGGAGGCAGTGGGAGGAGG + Intronic
1200715758 Y:6542245-6542267 CAGTAAGAGGTACTCTGAGGTGG - Intergenic