ID: 921508693

View in Genome Browser
Species Human (GRCh38)
Location 1:216005997-216006019
Sequence CAGTGTGACCGGAGATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921508693_921508695 5 Left 921508693 1:216005997-216006019 CCATCACATCTCCGGTCACACTG 0: 1
1: 0
2: 2
3: 8
4: 135
Right 921508695 1:216006025-216006047 CTCCTCTATGACTTCAGCATTGG 0: 1
1: 0
2: 2
3: 28
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921508693 Original CRISPR CAGTGTGACCGGAGATGTGA TGG (reversed) Intronic
901212414 1:7534096-7534118 CGGGGTGACCGGTGATGGGAGGG - Intronic
902682364 1:18052300-18052322 CAGTGTGACTCAAGATGTCAAGG + Intergenic
903471420 1:23590343-23590365 CGGTGTGTCTGGAGAAGTGATGG + Intronic
903998718 1:27324965-27324987 CAGTTTGACAGGAGATTTGGCGG + Intronic
906299738 1:44673391-44673413 CAGTGAGACAGGAGGCGTGAAGG + Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908878200 1:68701420-68701442 TAGTGTGATGGGAGATGAGAAGG - Intergenic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
910990690 1:93052971-93052993 CAGTTTGACAGGAGATTTGGTGG + Intergenic
915167896 1:153958680-153958702 CTGCGTGACTGGGGATGTGAAGG - Intergenic
916660624 1:166920133-166920155 CATTGTGCCCGTATATGTGAAGG - Intronic
918836787 1:189475532-189475554 TCGTCTGACTGGAGATGTGATGG - Intergenic
919370434 1:196717883-196717905 CTTTGTGACAGGAGATGGGAAGG + Intronic
921508693 1:216005997-216006019 CAGTGTGACCGGAGATGTGATGG - Intronic
922149982 1:222992710-222992732 AGGTGTGACAGGAGAAGTGATGG + Intronic
922754530 1:228088221-228088243 CCATGTGAGCAGAGATGTGAAGG + Intronic
923698804 1:236281361-236281383 GAGTGTGGCGGGAGATGGGACGG - Intronic
1069779641 10:70946577-70946599 CAGTGTGCCCTGAAATGGGAAGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070580872 10:77718403-77718425 CAGTGTTACAGGAGTTGTGGGGG + Intergenic
1073474948 10:103746733-103746755 CAGAGTGACAGGAGATGGGCGGG - Intronic
1076382597 10:130035605-130035627 AAGTGAGACAGGACATGTGAGGG - Intergenic
1076647215 10:131961576-131961598 CACTGTCACCAGAGATCTGAGGG - Intergenic
1077371614 11:2184801-2184823 GAGTGTGACGGGAGAGGTGCTGG - Intergenic
1077611466 11:3645539-3645561 CAGTGTCAGGGGAGATGTGGTGG - Intronic
1079997199 11:27306723-27306745 CAGTTTTACTGGAGATGTGGAGG - Intergenic
1085016664 11:73178353-73178375 AATTGTGACCCCAGATGTGAGGG + Intergenic
1088456074 11:110034307-110034329 CTGTGTGACTGGAGCTGTGTGGG - Intergenic
1088938563 11:114430227-114430249 AAGTTTGACTGAAGATGTGAAGG - Intronic
1089349559 11:117814676-117814698 CAGTGGGGCCTCAGATGTGAAGG + Intronic
1089349797 11:117815879-117815901 CAGTGGGGCCTCAGATGTGAAGG - Intronic
1093566861 12:20616626-20616648 CATTGTGACCTTAGATGGGAAGG + Intronic
1095576756 12:43749193-43749215 CAGGGTTACAGGATATGTGAAGG - Intronic
1098184393 12:67880635-67880657 CAGTCTGACTTCAGATGTGAAGG - Intergenic
1103730950 12:123027458-123027480 CAGTCTGCCCAGAGATGTGGTGG - Intronic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1106024059 13:25940569-25940591 CAGTGGGACCTGTGCTGTGAAGG - Intronic
1106455672 13:29924610-29924632 CAGTGACACCAAAGATGTGAAGG - Intergenic
1115678985 14:35715235-35715257 CATTGAGACGGGAAATGTGAAGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1121896014 14:97648536-97648558 AAGGGTGACCTGAGATGGGAGGG - Intergenic
1123903059 15:24895530-24895552 CAGCTTGACCAGATATGTGATGG - Intronic
1124188626 15:27551927-27551949 CAATGTGACATGAGATTTGATGG - Intergenic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125479249 15:40069294-40069316 GAGTGTGACCGGAGCTGGCAGGG + Intergenic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1126341734 15:47648364-47648386 GAGTGTGCCCTGAGATGGGATGG + Intronic
1127310080 15:57744690-57744712 CAGTGTTACAGGAGATGTGAGGG - Intronic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1131881003 15:96862083-96862105 CTGTGTGGCCGCACATGTGAAGG + Intergenic
1132262573 15:100439839-100439861 CAGTTTGACAGGAGTTGTGGAGG - Intronic
1133408696 16:5549843-5549865 CAGTGTCATCTGAGATGGGAGGG + Intergenic
1134024453 16:10943221-10943243 CAGTGTGGCCTGAGATTTAAAGG - Intergenic
1134214379 16:12305458-12305480 AAGTGTGCCCAGAGAAGTGAAGG - Intronic
1138389567 16:56660427-56660449 CAAAGTGACTGGAGATGTGGAGG + Intronic
1141354688 16:83334137-83334159 CAGAGTGATGGGATATGTGAAGG - Intronic
1142709216 17:1714574-1714596 CAGGGTGGCCGGGGCTGTGAGGG + Intergenic
1144752303 17:17657669-17657691 CAGTGTGACCCTGGATGTAATGG - Intergenic
1145414600 17:22704187-22704209 CAGTGCGACCGGTGAGGGGAGGG + Intergenic
1146648860 17:34593896-34593918 CAGCGTGACCGGAGACGAGCAGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148103506 17:45107088-45107110 CTGTATGAGCGGAGAGGTGACGG - Exonic
1153389908 18:4544706-4544728 GAGTGTGCCCTGTGATGTGATGG + Intergenic
1157490463 18:48120262-48120284 CAGGGTGACAGGAGATGAGGTGG + Intronic
1159772085 18:72558260-72558282 CAGAGTGTCCAGAGATGTTATGG - Intronic
1160506820 18:79432032-79432054 CAGTGTGTCCTGAGGTGTGGGGG + Intronic
1160528324 18:79549812-79549834 CAGTGGGGCCTGGGATGTGAAGG - Intergenic
1161508621 19:4657958-4657980 CAGCTTCACCGGAGATGAGAAGG + Exonic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1166835447 19:45664890-45664912 CAGTGTGACCGTGGGGGTGAGGG + Intergenic
1167776488 19:51561030-51561052 CAATATGACAGGTGATGTGATGG + Intergenic
1168596573 19:57682391-57682413 CAGTGTGTACGGAAATGTGACGG + Intronic
926381437 2:12294497-12294519 CAGAGTGACCGGAGGTGAGTGGG + Intergenic
929600563 2:43201755-43201777 AAGTGTGAGGGGAGATGAGAGGG + Intergenic
931591503 2:63888600-63888622 GAGTGTGCCCTGAGATGGGATGG - Intronic
931800752 2:65755818-65755840 CAATTTGACAGGAGATTTGATGG + Intergenic
932986388 2:76730859-76730881 CAGTGTGACCGCTGCTGAGATGG + Intergenic
933048113 2:77564783-77564805 GAGTGTGCCCTGAGATGGGATGG - Intronic
935568314 2:104632969-104632991 CACTGTCACCATAGATGTGATGG + Intergenic
938786823 2:134637358-134637380 GAGTGTGCCCTGAGATGAGATGG + Intronic
944524318 2:200602681-200602703 CATTGTGACCAAAGCTGTGACGG - Intronic
945045378 2:205776891-205776913 CAGTCTGCCAGGAGACGTGAGGG + Intronic
947355901 2:229295250-229295272 GAGTGTGATTGGAGAAGTGAAGG - Intergenic
948061503 2:235045914-235045936 CAGTGTGCAGGGAGATGGGAAGG + Intronic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
1169837007 20:9891279-9891301 CAGTTTGACATGAGATTTGAAGG + Intergenic
1171396451 20:24836979-24837001 CAATGTGACAGGAGATTTGGGGG + Intergenic
1173590717 20:44222639-44222661 CAGTTTGACCTGAGATTTGGAGG - Intergenic
1174182938 20:48686531-48686553 CAGTTTGGCAGGAGATGGGAAGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182677484 22:32050967-32050989 CTGTCTGTGCGGAGATGTGATGG + Intronic
1183776837 22:39971626-39971648 GAGTCTGAGCGGGGATGTGAAGG + Exonic
1184152874 22:42648878-42648900 GAGTGTGACCGTGGGTGTGAAGG - Intronic
958693607 3:97500187-97500209 CAGTGTGACAAAAGATGTGGAGG - Intronic
960125308 3:113992139-113992161 CAGTGTGTCCAGTGATGTGCTGG - Intronic
960275945 3:115729376-115729398 CATTGTACCAGGAGATGTGATGG - Intergenic
961804552 3:129479932-129479954 CAGCCTGACAGGAGACGTGAGGG - Intronic
961811604 3:129525095-129525117 GAGTGTGAGCGGAGACCTGAAGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965890735 3:173510740-173510762 TAGTCTGACAGGAGATGAGAAGG + Intronic
967811804 3:193766877-193766899 CAGTGGGACCGGAGGAGTCAGGG - Intergenic
971262107 4:25066547-25066569 AAGGCTGACAGGAGATGTGATGG + Intergenic
972789174 4:42354345-42354367 CATTGTGACATGAGCTGTGAAGG + Intergenic
973206768 4:47569792-47569814 GACTGTGAGCAGAGATGTGAAGG + Intronic
976353708 4:84089784-84089806 GAGTGAGACTGGAAATGTGAGGG + Intergenic
987108779 5:14665168-14665190 CTGTGTGACCAGAATTGTGAGGG - Intronic
987860428 5:23479721-23479743 TAGTTTGACCGGAGACTTGATGG - Intergenic
987910614 5:24139269-24139291 CATTGTGACTGCACATGTGAGGG - Intronic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
992179192 5:74180297-74180319 TAATGTGACCGGTTATGTGATGG - Intergenic
994081714 5:95714572-95714594 CAGTGTGACCGGAGTGGTGGAGG + Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999565885 5:152860902-152860924 CACTGTGATCGGAGCTATGAAGG - Intergenic
1000168338 5:158677274-158677296 GAGAGAGACCGGAGATGAGAAGG - Intergenic
1002859442 6:1067155-1067177 CTGTGTGACCGTGGATGTGTCGG + Intergenic
1013665016 6:112338830-112338852 CAGTGTCTCTGTAGATGTGAGGG - Intergenic
1014171568 6:118284540-118284562 CAGTATGCCAGGACATGTGATGG + Intronic
1019793432 7:3032440-3032462 CAGTTTGACCTCAGAGGTGAGGG + Intronic
1021962503 7:25886991-25887013 CACAGTGACAGGAGATGAGATGG - Intergenic
1031199759 7:118666134-118666156 TTGAGTGACCTGAGATGTGAGGG + Intergenic
1038785368 8:30609703-30609725 CAGTTTGACATGAGATTTGATGG - Intronic
1039570918 8:38585753-38585775 CAGTGTGTCCCGCCATGTGATGG - Intergenic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1045717970 8:105070634-105070656 CAGTGAGACAGGATATGGGAGGG + Intronic
1045932119 8:107639286-107639308 CAGAGTGAGAGGAGATGTGAGGG - Intergenic
1045942089 8:107751038-107751060 CAGTGTCTCTGGAAATGTGAGGG + Intergenic
1047977189 8:130142208-130142230 CAGAGTGACCGCAGAAGAGAAGG - Intronic
1048472547 8:134716439-134716461 CAGGCAGACCGGGGATGTGATGG - Intergenic
1048874347 8:138825284-138825306 CAGTATGACCAGGGATGTTATGG + Intronic
1050307186 9:4316661-4316683 GAGTGTGCCCTGAGATGGGACGG + Intronic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1051268788 9:15334684-15334706 AAGTGTGAGAGGAGATGTCAAGG - Intergenic
1052091242 9:24330163-24330185 CAGTTTGACTTGAGATATGAAGG - Intergenic
1052792706 9:32890776-32890798 CAGGGTCACTGGAGGTGTGATGG - Intergenic
1055527682 9:77151764-77151786 CAGTTTGACCAAAGATTTGAAGG + Intergenic
1055941412 9:81653803-81653825 CAGTGTGCCCTCAGATGTGTTGG + Intronic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1187541098 X:20196168-20196190 CAGTGTAAGCAAAGATGTGAAGG + Intronic
1190326965 X:49212490-49212512 CAGTGAGACCAGAGGTGTGTTGG + Intronic
1190908288 X:54749664-54749686 GGGTGAGACTGGAGATGTGAAGG + Exonic
1199472961 X:148215244-148215266 CAGTGGGGCCTGAGATGGGATGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1202199013 Y:22327327-22327349 CACTGTGACAGCAGATGTCAAGG + Intronic