ID: 921512980

View in Genome Browser
Species Human (GRCh38)
Location 1:216054796-216054818
Sequence GTCCAATTACAGACAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921512980_921512985 26 Left 921512980 1:216054796-216054818 CCTTGGCCTGTCTGTAATTGGAC 0: 1
1: 0
2: 1
3: 11
4: 196
Right 921512985 1:216054845-216054867 TTTTAATTCAATTAAAGAACTGG 0: 1
1: 0
2: 2
3: 45
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921512980 Original CRISPR GTCCAATTACAGACAGGCCA AGG (reversed) Intronic
900800482 1:4734125-4734147 ATCCAAATACAGACCTGCCAGGG + Intronic
902279249 1:15362401-15362423 ATCCACTTACAGACAGGGAAAGG - Intronic
904166755 1:28561563-28561585 GACCAAATACAGAAAAGCCAGGG - Intronic
905002826 1:34686600-34686622 GTCCAAGAACAGGCTGGCCAGGG - Intergenic
909278373 1:73718178-73718200 GCCCAGTTTCTGACAGGCCATGG - Intergenic
909730209 1:78880111-78880133 GTCCAATTAGAGAGTGTCCAAGG - Intergenic
913508641 1:119542330-119542352 GTACAAAAACAGACTGGCCATGG - Intergenic
913657123 1:120971875-120971897 GTCCCATTCCTAACAGGCCATGG + Intergenic
914521686 1:148423129-148423151 GTCCCATTCCTAACAGGCCATGG + Intergenic
914647096 1:149663610-149663632 GTCCCATTCCTAACAGGCCATGG + Intergenic
915404942 1:155652797-155652819 GTCCCAGTATACACAGGCCAGGG + Intergenic
916653347 1:166850584-166850606 GCCCAGTTCCTGACAGGCCATGG - Exonic
918265199 1:182836052-182836074 GCCCCATTCCTGACAGGCCATGG + Intergenic
920377067 1:205514522-205514544 TTCCACTTTCAGGCAGGCCAGGG - Intronic
920908793 1:210194920-210194942 GTCCAATTAGAGAGTGTCCAAGG - Intergenic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
922844949 1:228677346-228677368 GTCCAATTACAGAGTGTCAAAGG + Intergenic
1065697290 10:28391378-28391400 GCCCAGTTCCTGACAGGCCATGG - Intergenic
1067224633 10:44367603-44367625 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1069630678 10:69895329-69895351 GGCCACTTCCAGGCAGGCCATGG + Intronic
1070097795 10:73355157-73355179 GCCCAGTTCCTGACAGGCCACGG - Intronic
1071281638 10:84109235-84109257 GTGCAGTTACAGGCACGCCATGG - Intergenic
1071360111 10:84838051-84838073 GTCCAACTACAGAAAGGCATGGG + Intergenic
1071957611 10:90776872-90776894 GTCCACATACAGAGAGGCAAAGG + Intronic
1074895257 10:117771939-117771961 GCCCAAATATAGACAGGACATGG + Intergenic
1078789505 11:14528253-14528275 GTCCAATTAGAGAGTGTCCAAGG - Intronic
1079000381 11:16749494-16749516 GTCCAGTTTCTAACAGGCCAGGG - Intronic
1079003537 11:16776970-16776992 GTCCAATTCAAGACAGCGCAGGG - Intergenic
1079434195 11:20429387-20429409 GTCCAGTTCCTAACAGGCCACGG + Intronic
1084495752 11:69502095-69502117 GTCCATGGACAGGCAGGCCATGG - Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089559606 11:119337216-119337238 GTCCAAATACAGAAGGGCCCAGG + Exonic
1091770989 12:3151324-3151346 GCCCAATTACATACAGTGCAGGG - Intronic
1092094903 12:5833582-5833604 GTCCAGTTCCTAACAGGCCATGG - Intronic
1095183581 12:39175256-39175278 GTTCAATTCCTAACAGGCCACGG - Intergenic
1095589679 12:43889537-43889559 GTCCAGTTCCTAACAGGCCATGG + Intronic
1097906631 12:64926531-64926553 GCCCAGTTACTAACAGGCCATGG - Intergenic
1099155310 12:79168059-79168081 GTCCAGTTCCTAACAGGCCATGG + Intronic
1099155635 12:79172450-79172472 GTCTATTTAAAGACAGGCCTTGG + Intronic
1100416892 12:94387225-94387247 GCCCCATTCCTGACAGGCCATGG - Intronic
1102455365 12:113067405-113067427 GGCAAATTAGAGACAGGCCTTGG - Intronic
1103629823 12:122251113-122251135 GGCCAATTATTGCCAGGCCATGG + Intronic
1104751694 12:131244330-131244352 GTGCAATTAGAGACAGACCTGGG - Intergenic
1104780200 12:131414745-131414767 GTGCAATTAGAGACAGACCTGGG + Intergenic
1107067124 13:36226526-36226548 GCCCAATTCCTAACAGGCCATGG + Intronic
1109189232 13:59305801-59305823 GTCCAGTTCCTAACAGGCCAAGG + Intergenic
1109410717 13:61964244-61964266 GTCCCATTCCCAACAGGCCATGG + Intergenic
1109830547 13:67781420-67781442 GTCCAGTTCCTAACAGGCCACGG + Intergenic
1109928698 13:69183787-69183809 GCCCAGTTCCTGACAGGCCAAGG + Intergenic
1110477010 13:75928043-75928065 GTCCAGTTCCCAACAGGCCATGG - Intergenic
1112165142 13:96910196-96910218 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1114234933 14:20815306-20815328 GTCCAATTAGAGAGTGTCCAAGG + Intergenic
1114889868 14:26906649-26906671 GGCCAATTATAGAGAGGCTATGG + Intergenic
1115308569 14:31957037-31957059 GCCCAGTTCCAGACAGGCCATGG - Intergenic
1115457326 14:33618608-33618630 GTCCGATTCCTAACAGGCCACGG + Intronic
1115569624 14:34654393-34654415 GTCCAATTAGAGAGTGTCCAAGG - Intergenic
1115824091 14:37245743-37245765 TTCAAATTACAGAAAGGCAATGG + Intronic
1116955194 14:50916046-50916068 GTCCTGTTGCAGACAGGGCAGGG - Intronic
1117691632 14:58313508-58313530 GTCCGGTTACCAACAGGCCATGG + Intronic
1119328245 14:73774983-73775005 GTTCAATTGCAGAAATGCCATGG + Intronic
1119454475 14:74742917-74742939 GTCCAGTTCCTAACAGGCCATGG + Intergenic
1121798189 14:96753011-96753033 ACCCAATTCCTGACAGGCCATGG - Intergenic
1121993791 14:98585988-98586010 GTCCCAGTATAGAAAGGCCAGGG + Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1123121279 14:105918201-105918223 GACCACTTACACACGGGCCAGGG - Intronic
1128964937 15:72049553-72049575 GCCCAGTTTCTGACAGGCCATGG - Intronic
1129682224 15:77664372-77664394 TTCCCATAACAGACAGGCCTGGG - Intronic
1129752428 15:78075747-78075769 ACCCACTTACAGACAGGACAGGG + Intronic
1129828794 15:78653485-78653507 GTCCACTGACAGCCAGGCAAAGG + Intronic
1130840388 15:87694417-87694439 GTCCAACTACAGGAAGCCCATGG + Intergenic
1131565690 15:93483436-93483458 GCCCAGTTCCAAACAGGCCACGG - Intergenic
1132463345 16:66405-66427 GCACAATTAGAGACAGCCCAGGG + Intronic
1135352985 16:21745680-21745702 ATCCAAGTTCAGAGAGGCCACGG - Intronic
1135451471 16:22561803-22561825 ATCCAAGTTCAGAGAGGCCACGG - Intergenic
1136126844 16:28189480-28189502 GTCCTATCACAGTCAGGCTAAGG - Intronic
1136553105 16:30992176-30992198 GCCCAGGTACACACAGGCCATGG - Exonic
1141783665 16:86182969-86182991 GTACAATAAAAAACAGGCCATGG - Intergenic
1141786942 16:86207435-86207457 GGCCAATTACAGCCATGCCTGGG - Intergenic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1142629776 17:1217257-1217279 ATCCAATTACAGACGCGTCACGG - Intronic
1152149687 17:78591161-78591183 GTCCAAGTACACACAGGGCGGGG + Intergenic
1152454722 17:80407403-80407425 GTCCAATTAGAGAGTGTCCAAGG - Intergenic
1155316764 18:24579400-24579422 GACCCATAACAGACAGCCCAGGG - Intergenic
1157427009 18:47592753-47592775 GTACTTTTACAGACAGGTCAAGG + Intergenic
1159222375 18:65481516-65481538 GCCCAGTTCCAAACAGGCCACGG + Intergenic
1161097545 19:2401573-2401595 GTCCTATTGCAGGCAGGTCATGG - Intronic
1161223952 19:3133679-3133701 GTCCCTTTACAGATAGGGCAAGG - Intergenic
1164137976 19:22431162-22431184 TTCCACTTTCTGACAGGCCAAGG - Intronic
1165600028 19:37046717-37046739 ATACATTTACATACAGGCCAAGG + Intronic
1166396881 19:42447743-42447765 GTCCAATTAGAGAGTGCCCAAGG + Intergenic
1168587901 19:57608881-57608903 GTTCAATAACAGCCTGGCCAAGG + Intronic
925194212 2:1910253-1910275 GTCCAAGTCCAGCCAGGCCTCGG - Exonic
926526484 2:13987443-13987465 GTCGAATTCCTAACAGGCCAGGG + Intergenic
927240286 2:20915024-20915046 GTCTGATAGCAGACAGGCCATGG - Intergenic
928501820 2:31904680-31904702 GTCCAGTTCCTAACAGGCCACGG + Intronic
929004047 2:37378500-37378522 GGCCAATGGCAGTCAGGCCAAGG - Intergenic
929194917 2:39175147-39175169 GTACAATTTCATAGAGGCCATGG + Intergenic
929569222 2:43009501-43009523 GTCCAGTTCCTAACAGGCCATGG - Intergenic
931323380 2:61194461-61194483 GTCCATATAAAAACAGGCCATGG - Intronic
931388289 2:61816758-61816780 GTTAAAGTACACACAGGCCAGGG - Intergenic
931774774 2:65531154-65531176 GCCCAGTTTCTGACAGGCCATGG + Intergenic
933006118 2:76997726-76997748 GCCCAATTCCTAACAGGCCATGG - Intronic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
938193531 2:129304283-129304305 GTCTTATTACAGACTGGCCAGGG - Intergenic
939004591 2:136771265-136771287 GGCCAATCACAGAGAGGCAAGGG + Intronic
939278069 2:140027498-140027520 GTCCAGTTTCTAACAGGCCACGG - Intergenic
939314382 2:140529043-140529065 GTCCAAATAAAGATAAGCCAAGG + Intronic
941212093 2:162652677-162652699 GTCCAGTTCCTAACAGGCCACGG + Intronic
941449535 2:165643268-165643290 GTCCAAGTAAGGACAGGTCAGGG - Intronic
943156641 2:184187759-184187781 GCCCAGTTCCAAACAGGCCATGG + Intergenic
945794257 2:214342277-214342299 GTCCAGTTTCTAACAGGCCAAGG - Intronic
946500742 2:220244905-220244927 GTCCAGTTCCTAACAGGCCAGGG + Intergenic
947842338 2:233215899-233215921 GTCCAATTAGAGAGTGTCCAAGG + Intronic
948271187 2:236674412-236674434 GTCCAGTTCCTAACAGGCCATGG + Intergenic
1171301423 20:24064194-24064216 GCCCAATTCCTAACAGGCCAAGG - Intergenic
1173477126 20:43367994-43368016 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1176218493 20:63959187-63959209 GGAGAATTACAGACAGGCCTGGG + Exonic
1178028370 21:28494392-28494414 GTCCTACTTCAGACAGGACATGG - Intergenic
950881726 3:16327927-16327949 GTCCAGTTACACACAGAGCAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954731390 3:52665519-52665541 GCCCAGTTCCAAACAGGCCATGG - Intronic
955141470 3:56274074-56274096 GTCTAATTCCTAACAGGCCATGG - Intronic
956060914 3:65347147-65347169 CTCCAATTACAGACACTCAAGGG + Intergenic
956804585 3:72796528-72796550 GTCAAATAACAGGCAGGGCATGG + Intronic
956839101 3:73120684-73120706 GTCCAATTTGAGAAAGTCCAAGG - Intergenic
958261456 3:91386255-91386277 GCCCAATTCCTAACAGGCCACGG - Intergenic
959599101 3:108159133-108159155 GTCCAATTCCTAACAGGCCAGGG - Intergenic
960218724 3:115077054-115077076 GTCCAGTTCCTAACAGGCCAGGG + Intronic
964897906 3:161620443-161620465 GTCCAATTTCAGAGTGGCCTAGG - Intergenic
964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG + Intergenic
965286159 3:166823367-166823389 ATCCAATTAGAGAGTGGCCAAGG + Intergenic
967518463 3:190399789-190399811 GCCCAGTTACTAACAGGCCACGG - Intronic
967883864 3:194320275-194320297 GTCCAAATTCGGGCAGGCCAGGG - Intergenic
968412256 4:400357-400379 GTCCAATTAGAGAGTGTCCAGGG + Intergenic
968564952 4:1306952-1306974 GTCCATTTACATACAGCCAAGGG - Intronic
972015992 4:34246779-34246801 GTGAAATTACAGTCAAGCCAGGG - Intergenic
975693651 4:76990455-76990477 GCCCAGTTCCGGACAGGCCACGG - Intronic
976165262 4:82247781-82247803 GCCCAATTCCTAACAGGCCATGG - Intergenic
976587591 4:86816144-86816166 GTCCAATTACAAGAAGGCCTTGG + Intergenic
977180909 4:93872553-93872575 GTCCAGTTCCTAACAGGCCACGG + Intergenic
978835327 4:113142564-113142586 GTCCAAACAGGGACAGGCCAAGG - Intronic
981578338 4:146227967-146227989 GTACAAGCCCAGACAGGCCAGGG + Intronic
987017976 5:13839349-13839371 CTCCACTTACAGACAGGTGATGG - Exonic
987253220 5:16121633-16121655 TTCTAATTACAGAAGGGCCAAGG + Intronic
988199599 5:28051461-28051483 ATCCAATTACAGAGTGTCCAAGG - Intergenic
989627426 5:43443789-43443811 GCCCAGTTACTAACAGGCCATGG - Intergenic
990564668 5:57017223-57017245 ATCCAATTACAGAGTGCCCAAGG + Intergenic
990748594 5:58986445-58986467 GCCCAGTTCCTGACAGGCCACGG - Intronic
992451554 5:76880690-76880712 ATCCAATTACAGAGTGTCCAAGG + Intronic
992721668 5:79567032-79567054 TTCCCATTACACACATGCCAGGG + Intergenic
993746046 5:91598344-91598366 GGCCAATGAGAGACAGGCAAAGG + Intergenic
994635104 5:102335872-102335894 ATCCAGTTACAGACAGCCCCTGG + Intergenic
995071358 5:107925570-107925592 GGCCAATGACAGAAAGGCAATGG + Intronic
996034292 5:118740650-118740672 GTCCAGGTACAGAGAGGCCAAGG - Intergenic
1001353792 5:171001392-171001414 GTCCAATTAGAGAGCGTCCAAGG + Intronic
1002342634 5:178527001-178527023 GGCCAATTACAGCCAGGACGGGG + Intronic
1004121887 6:12831616-12831638 GAACAATTTCAGACAGGCCAAGG - Intronic
1004501076 6:16210748-16210770 GCCCAGTTCCTGACAGGCCATGG + Intergenic
1007459455 6:42007379-42007401 GTCCAATTGAAGTCAGGACAAGG + Intronic
1007776612 6:44227558-44227580 GTGGAAACACAGACAGGCCAGGG - Intronic
1008334116 6:50279665-50279687 TTCTAGTTAAAGACAGGCCAAGG + Intergenic
1013471956 6:110473953-110473975 GTCCAGTTTCTAACAGGCCATGG - Intronic
1013547541 6:111173479-111173501 GCCCAATTCCTAACAGGCCATGG - Intronic
1013683295 6:112548881-112548903 GTCAAATTAAAGGCAGGCCTAGG + Intergenic
1016023596 6:139261138-139261160 GTCCAATCAGAAACAGGACATGG + Intronic
1017249116 6:152260918-152260940 GTCCAGTTCCTAACAGGCCACGG + Intronic
1017576589 6:155811961-155811983 GTCCAATTACACGCACGGCAGGG - Intergenic
1019100424 6:169625395-169625417 GTCCAACTACTGAGAGGCCAGGG + Intronic
1019263124 7:93446-93468 GCCCAGTTCCTGACAGGCCACGG - Intergenic
1023729137 7:43173722-43173744 GCCCAGTTCCAAACAGGCCAAGG + Intronic
1024257895 7:47551949-47551971 GTGCATTTGCAGAGAGGCCAAGG - Intronic
1028781888 7:94746685-94746707 GACCAATTCCAGAAAGGCTAGGG - Intergenic
1029487305 7:100851362-100851384 GTTCAGTGACGGACAGGCCAGGG + Intronic
1030163122 7:106528537-106528559 GTCCAATTAAAGAGTGTCCAAGG + Intergenic
1030263348 7:107589611-107589633 GCCCAATTCCTGACAGGCCGTGG + Intronic
1031497228 7:122465425-122465447 GCCCAGTTCCAAACAGGCCATGG - Intronic
1037207692 8:16343340-16343362 GCCCAGTTACTAACAGGCCATGG - Intronic
1040405038 8:47092604-47092626 GTCCAATTCCTAACAGGCCAGGG + Intergenic
1041917011 8:63148156-63148178 GTCCAATTAGAGAGTGTCCAAGG + Intergenic
1043347063 8:79310745-79310767 GCCCAGTTACTAACAGGCCATGG + Intergenic
1045586327 8:103541133-103541155 ATCCAATTACAGGAAGGTCAGGG + Intronic
1047177844 8:122558298-122558320 GTCCGATTCCTAACAGGCCATGG + Intergenic
1047951108 8:129935559-129935581 GTCCAGTTCCAAACAGGCCACGG + Intronic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1051352755 9:16213873-16213895 GTCTGAATACAAACAGGCCAAGG - Intronic
1051577295 9:18631307-18631329 GTGCAATTACAGATAAACCAGGG + Intronic
1053564381 9:39232922-39232944 GAACAAATACACACAGGCCATGG + Intronic
1053613890 9:39744049-39744071 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053830164 9:42070823-42070845 GAACAAATACACACAGGCCATGG + Intronic
1053871924 9:42502006-42502028 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1053900825 9:42793971-42793993 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054132769 9:61386114-61386136 GAACAAATACACACAGGCCATGG - Intergenic
1054239626 9:62598348-62598370 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054260825 9:62863575-62863597 GTCCAACCACAGTCAGCCCAGGG + Intergenic
1054553759 9:66632875-66632897 GTCCAACCACAGTCAGCCCAGGG - Intergenic
1054600395 9:67116629-67116651 GAACAAATACACACAGGCCATGG - Intergenic
1055045357 9:71918509-71918531 GCCCAGTTCCTGACAGGCCATGG - Intronic
1060756219 9:126215840-126215862 GTGCAATTTTAGAGAGGCCAGGG - Intergenic
1188741625 X:33790535-33790557 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1189270266 X:39746567-39746589 TTCCACCTACAGAGAGGCCATGG - Intergenic
1197075382 X:122346363-122346385 GTCCACTTTCTAACAGGCCATGG + Intergenic
1198627327 X:138591703-138591725 GGCCAAATAAAGACAAGCCATGG + Intergenic
1198890964 X:141395698-141395720 ATCCAATTACAGAGTGTCCAAGG + Intergenic
1199835451 X:151585622-151585644 ATCCAAGGACAGACAGGCTATGG + Intronic
1201540375 Y:15099577-15099599 ATCCAATTACAGAGTGCCCAAGG + Intergenic
1201774797 Y:17650692-17650714 GTCCTATGATAGACAGCCCAAGG - Intergenic
1201826759 Y:18255297-18255319 GTCCTATGATAGACAGCCCAAGG + Intergenic
1202141356 Y:21727095-21727117 GTTCAAGTCCAGACTGGCCAAGG - Intergenic
1202145509 Y:21776707-21776729 GTTCAAGTCCAGACTGGCCAAGG + Intergenic