ID: 921514121

View in Genome Browser
Species Human (GRCh38)
Location 1:216068633-216068655
Sequence CTGAAGAAACAGAAAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921514121 Original CRISPR CTGAAGAAACAGAAAGAGTC AGG Intronic
900076089 1:819004-819026 CAGGAGAAACAGAGAGTGTCTGG - Intergenic
900767002 1:4512524-4512546 ATGAAGAGACAGAAAGAGATGGG + Intergenic
902297439 1:15477673-15477695 TTGAGGAAACAGAAAGATTGGGG - Intronic
904137919 1:28328406-28328428 CTCAAAAAAAAAAAAGAGTCTGG - Intergenic
904205074 1:28849067-28849089 CAGCAGACACAGAAAGGGTCAGG + Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
905874933 1:41426599-41426621 GGGAAGAATCAGAAAGGGTCTGG + Intergenic
906166032 1:43687041-43687063 TGGAAGAAACAGAAACAGACAGG - Intronic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
908397923 1:63743263-63743285 CTGATGAAACAGAGAGGGGCAGG + Intergenic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
909076765 1:71058436-71058458 CTTAAGAAACAGAAAAAAGCTGG + Intergenic
909171180 1:72298009-72298031 CTGAAGAAAAAAACAGACTCAGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910666475 1:89730262-89730284 ATGAAGACCCAGAAAGACTCTGG + Intronic
910749207 1:90610015-90610037 CTGAAGGAAAAGAAAGATTTGGG + Intergenic
910861641 1:91747962-91747984 CTAGAGAAACAGAACCAGTCGGG - Intronic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
912696131 1:111843484-111843506 CCAAAGAAGCAGAAACAGTCAGG - Intronic
912716033 1:111984244-111984266 CTGAAAAAACTCAAAGAGTTGGG - Intronic
912739890 1:112184575-112184597 CTGAAGGGCCAGTAAGAGTCAGG + Intergenic
913150491 1:116037528-116037550 CTGAAGCAAAGGAAAGAATCTGG - Intronic
913488330 1:119354696-119354718 ATGTGGAAACAGATAGAGTCAGG + Intergenic
914396437 1:147273577-147273599 CAGGAGAAACTGAAAGAATCAGG + Intronic
914457609 1:147850742-147850764 GTGAAGACACAGAGAGAGACAGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915734799 1:158077968-158077990 CTGCAGAAACAGAAAGAATGAGG - Intronic
915993828 1:160544533-160544555 CAGAAGAAAAATAATGAGTCTGG + Intronic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916858261 1:168774493-168774515 GTAGAGAGACAGAAAGAGTCTGG + Intergenic
916889239 1:169100570-169100592 CTGAAGAAGCAGAGAAAGTCAGG + Intergenic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917568681 1:176239209-176239231 AGGAAGAAATTGAAAGAGTCGGG - Intergenic
917911919 1:179657055-179657077 CTCAAGAAAAAGAAAAAATCAGG + Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918537835 1:185594101-185594123 CTGAATAAAAAGAAGGAATCAGG - Intergenic
918578213 1:186090896-186090918 GTGGTGAAACAGAAAGAATCCGG + Exonic
918635613 1:186770889-186770911 AAGAAGAGAGAGAAAGAGTCAGG - Intergenic
919230583 1:194768098-194768120 GTGAAGAAACAGTCAGAATCTGG - Intergenic
919469743 1:197963548-197963570 CTGAAGAACCTGATAAAGTCTGG - Intergenic
920350608 1:205335682-205335704 CTGAAGTAACAGATAGAAACAGG - Intergenic
920363317 1:205434476-205434498 TTTAAGAAAGAGAAAGAGCCAGG - Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923095889 1:230774900-230774922 CTAAAGATACAAAATGAGTCGGG - Intronic
923153079 1:231252292-231252314 TGGAAGGAAAAGAAAGAGTCAGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923908047 1:238407864-238407886 GTGAAGAAAGAGGAAGAGACAGG + Intergenic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
1064109419 10:12525324-12525346 GTGAAGAAAGAGAAAGAGATTGG - Intronic
1065262801 10:23942810-23942832 GTCAAGAAAAAGAAACAGTCTGG + Intronic
1065299304 10:24306606-24306628 CTGAAGCCATAGAAAGTGTCAGG + Intronic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1066043278 10:31574332-31574354 TTGAAGAAACACAAAGGGTGGGG + Intergenic
1067295355 10:44972444-44972466 CTGAAAAATCAGAAAGGGTCTGG - Intronic
1068801496 10:61145615-61145637 CAGAAGAAAAAGACAGAGTATGG - Intergenic
1069014670 10:63415798-63415820 CTGCAGAAAAAGATACAGTCTGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070383644 10:75903856-75903878 CTGAAGAGACAGAACTAGTTAGG - Intronic
1071465024 10:85931905-85931927 CTGGAGAAACTGAAGGACTCTGG - Intronic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1073053570 10:100684970-100684992 ATGAAGAAAAAGAAAGAGTTGGG + Intergenic
1073257024 10:102159162-102159184 CCCAAGAAAAAGAAAGAGTAAGG - Intronic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1073919843 10:108446126-108446148 CAGTAAAAACTGAAAGAGTCAGG - Intergenic
1073992653 10:109280618-109280640 CTGAAGAGAGAGAAAGAATTTGG + Intergenic
1076375570 10:129981706-129981728 ATGAAGAAATAGAAAGTATCAGG + Intergenic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1078316773 11:10300120-10300142 CTGAAGAAAAAGCAAGACTAGGG - Intergenic
1078383302 11:10863624-10863646 CTCAAAAAAAAGAAAAAGTCAGG + Intergenic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1079929239 11:26537329-26537351 CTGAAGCAACAGAAATATACGGG - Intronic
1080355446 11:31439286-31439308 CTGAAGGAAAGGAAAAAGTCTGG - Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1081004440 11:37717405-37717427 TTGAAGAGACAGAGAGAGTGGGG + Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1084343344 11:68524383-68524405 CTGAAGGAAAACAAAGAGTCTGG - Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085683136 11:78596753-78596775 CAGAAGAAACAGAACAAATCAGG - Intergenic
1085818536 11:79767993-79768015 CTGAATAAAAAGACAAAGTCTGG + Intergenic
1087513646 11:99129487-99129509 CTGAAGTACCTGAAAGAGACAGG + Intronic
1088392462 11:109329889-109329911 CTGAAGAAACTGAAAGTTGCTGG - Intergenic
1089745370 11:120613219-120613241 AAGAAGAAACAGAAAGTGTGAGG - Intronic
1090105201 11:123846684-123846706 CTGAAGAAATAGAAATCGACTGG - Intergenic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1090556129 11:127878492-127878514 ATGAAGAAACACACAGAGTGAGG + Intergenic
1090772994 11:129938265-129938287 CAGAGGGAACAGAGAGAGTCTGG - Intronic
1090883425 11:130854797-130854819 CCGAAGAAAGAGACAGAGACTGG - Intergenic
1091237472 11:134031689-134031711 GTGAATGGACAGAAAGAGTCTGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092347505 12:7728096-7728118 GTGAAGACACAGCAAGAGTGTGG - Intergenic
1092531410 12:9348674-9348696 GTGAAGGAGCAGAGAGAGTCAGG - Intergenic
1093897837 12:24594782-24594804 TTGAAGATTCAGAAACAGTCTGG - Intergenic
1094674560 12:32606569-32606591 CTGAAGAAAAAGACAGACTAGGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096986323 12:55760878-55760900 GTAAAGAAACAGTAAGAGGCCGG + Intronic
1096987332 12:55768722-55768744 CTCAAAAAAAAGAAAGAGGCTGG - Intronic
1097555310 12:61128929-61128951 CTTCAGAGACAGAAAGTGTCTGG + Intergenic
1098622624 12:72622067-72622089 ATAAAGAACCTGAAAGAGTCTGG - Intronic
1098628002 12:72697080-72697102 CTGAAAATACAGAATTAGTCAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099326560 12:81223316-81223338 CTGAAGAATGAGAAATTGTCAGG - Intronic
1100661488 12:96703818-96703840 CTGAGAAAATTGAAAGAGTCTGG - Intronic
1100666127 12:96755483-96755505 CTGAAGAATCTTAAAAAGTCAGG - Intronic
1101288425 12:103340815-103340837 CTGAAGACACAGCAATAGGCTGG + Intronic
1101334725 12:103786325-103786347 ATGTGGAAACAGAAAGATTCTGG + Intronic
1101463675 12:104924742-104924764 CTCAAAAAAAAAAAAGAGTCTGG + Intronic
1101538882 12:105646247-105646269 CTGATGAAACAAAATGAGGCTGG + Intergenic
1101623473 12:106415003-106415025 GTGAAGGAACAGAAAGAGTCTGG - Intronic
1101771628 12:107757029-107757051 CTGAAGAAACTGAAACAGTGGGG + Intronic
1101933659 12:109037457-109037479 GTGAAGAAACAAAAAAAGTAAGG - Intronic
1101953970 12:109197599-109197621 CTGAACAAACAGATAGTGGCAGG + Intronic
1101996704 12:109530735-109530757 CTGAAGAAACTGAAATTATCAGG + Intronic
1102362828 12:112303137-112303159 CTGAAGAAACTGAATGACCCTGG - Intronic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1105523951 13:21157227-21157249 CTAAAGAATCAGATACAGTCAGG + Intronic
1105661728 13:22503374-22503396 CCGAGGAAACAGACAGAGCCAGG + Intergenic
1106175596 13:27328300-27328322 GTGAGGAAACAGGAAGTGTCTGG - Intergenic
1107231089 13:38111395-38111417 GTGAAGAAACTGAAACAGTTTGG + Intergenic
1107336874 13:39364509-39364531 CAAAAGAAACAGAAATACTCTGG + Intronic
1107650709 13:42541893-42541915 CTGACCACACAGAAAGAATCAGG + Intergenic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1109321172 13:60811672-60811694 TTGCAGAGAAAGAAAGAGTCAGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110142310 13:72145563-72145585 CTGAAGAATGAGAAAAATTCAGG + Intergenic
1110556707 13:76868369-76868391 CTGAAAAAAAAAAAAAAGTCAGG + Intergenic
1112716914 13:102197450-102197472 GTAAAGAAACTGAGAGAGTCAGG - Intronic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113166243 13:107446664-107446686 ATTAAGAAACAGAAAGTGTTAGG - Intronic
1113211092 13:107982187-107982209 ATGAAGATTCAGAAAGATTCAGG + Intergenic
1114373619 14:22118303-22118325 ATAAAGAAACAGAAAGCTTCAGG - Intergenic
1117022033 14:51580688-51580710 CTGAGGAAAATGAAAGAATCAGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117274667 14:54180534-54180556 CTGAGGAATCAGAAAGTGTCAGG + Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1122506564 14:102235406-102235428 CGGAAGAAAAGGAAAGAGTGTGG + Intronic
1123148421 14:106156793-106156815 CTGATGAAACAGGAAGCCTCTGG - Intergenic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1125106981 15:35983030-35983052 CTGCAGAAATAGGAAGGGTCAGG + Intergenic
1126885727 15:53147771-53147793 TTGAGGAAAGAGAAAGAGTAAGG + Intergenic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127489832 15:59452107-59452129 CTGAAGAATCAGGAAGAGATGGG - Intronic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128151532 15:65366368-65366390 CTAAAGAAAAAGAAAGAGGCAGG + Intronic
1128626312 15:69208965-69208987 CTGAACATACAGAAAGATTGGGG - Intronic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1129105526 15:73304751-73304773 CTGAGGTAACAGAAGCAGTCAGG - Exonic
1129343807 15:74903952-74903974 CTGAAGAAACAGAAGTTGTTTGG + Intronic
1129887020 15:79045645-79045667 CTGAAGAAACTGAAAGTCACTGG - Intronic
1130666216 15:85872090-85872112 CTGAAGAAACTCTACGAGTCAGG - Intergenic
1130773016 15:86944055-86944077 CTGAAGGAAGAGTAAGAGTCAGG + Intronic
1131330533 15:91495222-91495244 ATGAAGAAACATATGGAGTCAGG + Intergenic
1131499882 15:92952139-92952161 TTGAAGAAACAGCCAGAGTTAGG - Intronic
1131905653 15:97139184-97139206 CTGAAGAGACAGAGAGATTTGGG + Intergenic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1133477746 16:6139719-6139741 ACCAAGAAACAGAAAGAGTGAGG - Intronic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1135180724 16:20271973-20271995 CTGCAGAGACATAATGAGTCAGG - Intergenic
1135251821 16:20906839-20906861 CTGTAGAAACACCAAGTGTCTGG + Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136681788 16:31970847-31970869 CTGATGAAACAGGAAGCCTCTGG + Intergenic
1136782095 16:32912349-32912371 CTGATGAAACAGGAAGCCTCTGG + Intergenic
1136887693 16:33941503-33941525 CTGATGAAACAGGAAGCCTCTGG - Intergenic
1138915406 16:61457533-61457555 CTGCAGAAACACAAAGAATCAGG - Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1139764423 16:69215002-69215024 CTGAAAATACAGAATTAGTCAGG - Intronic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1203084757 16_KI270728v1_random:1176335-1176357 CTGATGAAACAGGAAGCCTCTGG + Intergenic
1143383258 17:6509440-6509462 CTGATAAACCAGAAAGTGTCAGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1144123262 17:12177575-12177597 CTTAAGAAACAGACTTAGTCAGG - Intergenic
1144216309 17:13058564-13058586 TTTAAGAAACAGTAAGAGTCAGG + Intergenic
1144223724 17:13123866-13123888 CAGAAAAAACAGAACGACTCTGG + Intergenic
1144244092 17:13346092-13346114 GTCAGGAGACAGAAAGAGTCAGG + Intergenic
1144535812 17:16090120-16090142 CTGAAGAAACTGAACCAGGCTGG - Intronic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146766102 17:35523258-35523280 ATGAAGTAACATAAAGAGTCTGG + Intronic
1146984965 17:37207186-37207208 TTAAAGTAACAGAAAGTGTCTGG + Intronic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148345455 17:46900543-46900565 CTCAAGAAATAGAAAGGGCCAGG - Intergenic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148847759 17:50539161-50539183 CAGAAGGCACAGAAAGAGTTAGG - Intronic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1149584595 17:57777208-57777230 TAGAAAAAAAAGAAAGAGTCCGG + Intergenic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151557027 17:74851839-74851861 CTGAACAAACAGCAGGTGTCAGG - Intronic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1152053615 17:78002932-78002954 TAGAAGAAAAAGGAAGAGTCAGG + Intergenic
1152408469 17:80110454-80110476 CTGCAGAACCAGAGAGCGTCAGG - Intergenic
1152593640 17:81227253-81227275 CTTAAGAAACTGAAAAAGGCTGG + Intergenic
1154933111 18:21021266-21021288 CAGAAGAGAGAGAAAGATTCAGG + Intronic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156443039 18:37210949-37210971 CAGAAGAATCAGAAAGTGTGTGG - Intronic
1158223344 18:55172408-55172430 CTAAAGAAAAGGAAAGAGTGGGG + Intergenic
1158270652 18:55711681-55711703 GTGAAGAAAAATGAAGAGTCTGG - Intergenic
1159163889 18:64678218-64678240 CAAAAGCAACAGGAAGAGTCCGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162851704 19:13436123-13436145 CTGAAGAAACAGGCAAAGGCAGG - Intronic
1163895738 19:20057375-20057397 CTGAAGTAAAGGAATGAGTCTGG - Intergenic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1165726446 19:38116211-38116233 ATTAAGAAACATAAAGAGACCGG + Intronic
1166168266 19:41007920-41007942 CAGAAGAACCAGAAGCAGTCTGG - Intronic
1166538311 19:43589958-43589980 CTCAGGCATCAGAAAGAGTCAGG + Exonic
1166835509 19:45665383-45665405 CTCAAAAAAAAAAAAGAGTCGGG + Intergenic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1168063920 19:53908927-53908949 AGGAAGAGACAGAAAGAGACAGG - Intergenic
1168249436 19:55133363-55133385 GTGGAGAAACAGAGAGATTCAGG + Intronic
1168319960 19:55503235-55503257 CGGAAGATACAGAAACAGTTTGG - Intronic
925716800 2:6791604-6791626 TTGAAGAAAGAGAAAGATACTGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926337558 2:11875583-11875605 TTGAAGAAACAGTGACAGTCAGG - Intergenic
927022000 2:19027039-19027061 CTGAGGATACAGAAATAGTTTGG + Intergenic
927041670 2:19236826-19236848 CTGAGGAAACAGAGAGAATGGGG - Intergenic
927079843 2:19616581-19616603 GTGAAGAAACTTAAAGAGGCTGG + Intergenic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
928380521 2:30813958-30813980 CTGAAGACACAAAAAGAGACTGG + Intronic
928591663 2:32823200-32823222 CTCTAGAAAGAGAAAGAGCCAGG + Intergenic
928664420 2:33536692-33536714 GAGAAGAGACAGAAAGAGACTGG - Intronic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
929226587 2:39517097-39517119 CTAAAGAAACTCAATGAGTCAGG + Intergenic
929478849 2:42282323-42282345 CTTAACATACTGAAAGAGTCAGG + Intronic
929542976 2:42836557-42836579 CTGATAAAACAGGAAGAGTCTGG + Intergenic
929666323 2:43836817-43836839 CTTAAAAAAGAAAAAGAGTCTGG + Intronic
930501562 2:52226335-52226357 CTAAAGGAACAGAAAAGGTCTGG + Intergenic
930781452 2:55228031-55228053 CTGAAGAAAGAGTAAAAGCCAGG - Exonic
932000897 2:67883443-67883465 CTGAACAAACAGAAAGCAACAGG + Intergenic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932823634 2:74921559-74921581 CAGAGGAAAAGGAAAGAGTCTGG - Intergenic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
935100837 2:99994342-99994364 CCAAAGAAACAGAAAGAGAGAGG + Intronic
935380674 2:102448086-102448108 CTCAAGAAACAGCCATAGTCTGG - Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935700053 2:105803871-105803893 TTCCAGAAACAGAAAGACTCTGG - Intronic
936726557 2:115324918-115324940 CTGAAGAGAGAGAGAGAGACAGG + Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940691822 2:156927878-156927900 CAGAAGCAAGAGAAAGAGTGGGG + Intergenic
941740200 2:169027902-169027924 TTGAAGAAAAAAAAAGGGTCAGG + Intronic
942072493 2:172328500-172328522 CTGCAAGAACAGAAAGATTCTGG - Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
943179177 2:184521443-184521465 CTCAAGAAGCTGAAAGAGCCAGG + Intergenic
943285367 2:185991677-185991699 CTGGAGAAAGAGAAAGACACTGG + Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
944400979 2:199325929-199325951 CTGAAGAAATAAAAAGAGACTGG + Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944615342 2:201453187-201453209 CAGAAGAAACAGACACAATCTGG - Intronic
944977592 2:205073599-205073621 CAAAGAAAACAGAAAGAGTCTGG - Intronic
945611410 2:212009354-212009376 GTGAAGATAGAGAAAGAGACTGG + Intronic
946301593 2:218827630-218827652 CTGCAGAAAGAGCCAGAGTCAGG + Intronic
946501119 2:220248395-220248417 GTGAAGAAATAAAAAGAGTGTGG + Intergenic
946986667 2:225281445-225281467 AGGAGGAAACAGAAAGAGTGAGG - Intergenic
947173903 2:227341068-227341090 CTGTGGAAACTGAAAGAATCAGG + Intronic
947400854 2:229730331-229730353 CTGAACAAACAGGAAGAATTTGG - Intergenic
948275447 2:236704749-236704771 GTGAGGACACAGGAAGAGTCAGG + Intergenic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1170405921 20:16036492-16036514 ATGCAGAAATAGAAAAAGTCTGG - Intronic
1170848932 20:19986296-19986318 CTTAATAAACATAAAGAGTAGGG - Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171025971 20:21630584-21630606 CTGTAGGGAAAGAAAGAGTCAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171233395 20:23505582-23505604 TTGAAGAATGAGAAAGAGTGGGG + Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1171907738 20:30913903-30913925 CAGAAGACACAGAGAGAGACAGG - Intergenic
1172811360 20:37650437-37650459 CTGAAGAAACGGGGAGAGTGGGG + Intergenic
1172960101 20:38792933-38792955 CTGAAAAAACAAAATGAGTTGGG - Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174863490 20:54114248-54114270 GTGAAGGAAAAGAAAGAGGCTGG + Intergenic
1174911167 20:54608969-54608991 ATGAAGAAACAGAGGGAGTTTGG - Intronic
1175382621 20:58574294-58574316 CTCAAGAAACAGCAACAGTAGGG + Intergenic
1177279290 21:18958949-18958971 CTAAAGAAACAGATATAGACAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178195903 21:30344786-30344808 CTGAAGAAAGGGAGAGAGACAGG - Intergenic
1178575472 21:33784865-33784887 CTGAAGAAACCCCAAGAGTCAGG - Intronic
1179087871 21:38236500-38236522 CTTAAGAAAATGAAAGTGTCAGG - Intronic
1181436157 22:22912127-22912149 CTGATGAACCAGAAACAGTGGGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182259985 22:29066956-29066978 GTGAAGGAAGAGAAAGACTCTGG - Intergenic
1183435808 22:37794227-37794249 CTTAAGAAACACAAACAGGCTGG + Intergenic
949288271 3:2432087-2432109 ATGAAGAAACAAAAATATTCTGG - Intronic
949647417 3:6111975-6111997 GGCAAGAAACAGAAAAAGTCAGG - Intergenic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952878467 3:37967772-37967794 CTGAAGGAACAAAAAAACTCTGG - Intronic
953341411 3:42137254-42137276 GGGAAGAAACAGAAATAGCCTGG - Intronic
953500838 3:43432392-43432414 CTAAAGAAACAAAAATATTCAGG - Intronic
953510947 3:43538608-43538630 CTGAAGAAACGGAAAAAATGAGG + Intronic
953950556 3:47186327-47186349 CTGAAGAAAAATAAATAATCTGG - Intergenic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954702210 3:52456173-52456195 TTGAAGAAAGAGAAGGCGTCAGG + Intronic
955829820 3:62989364-62989386 ATCATGAAACAGAATGAGTCAGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955982202 3:64538532-64538554 ATGTATAAACAGAAAAAGTCTGG - Intronic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956321450 3:68001234-68001256 CAGAAGAAAAAGAAAGAATAAGG - Intergenic
957771964 3:84706283-84706305 CTGAAGAACAATAAAGGGTCTGG - Intergenic
958130678 3:89417671-89417693 CTTAGGATACAGAAAGAATCAGG - Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
962351769 3:134661571-134661593 GAGAAGAAACACAAAGAATCTGG + Intronic
965019086 3:163203095-163203117 CTGAATAAAGTGAAAGAGACTGG + Intergenic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967263587 3:187670184-187670206 CTGCAGAAACTGACGGAGTCTGG + Exonic
967422509 3:189289362-189289384 CAGTAGGAACAGAAAGAGTTAGG - Intronic
967815560 3:193795589-193795611 ACGAAGAAGCAGACAGAGTCAGG - Intergenic
968826413 4:2901067-2901089 CTGAAGAAGCAGTTAGAGTTGGG + Intronic
969459804 4:7322916-7322938 CAGCAGAAACTGAAACAGTCTGG - Intronic
969493518 4:7513075-7513097 CTGAAGAATCAGACAGACCCAGG + Intronic
970044480 4:11835484-11835506 CTGAAGCAAGAGAAAGCGTTGGG + Intergenic
970734440 4:19149640-19149662 CTGAAGAATCAATAGGAGTCAGG - Intergenic
973824821 4:54694288-54694310 CTGAAGAAAAAGCAAGAGGTGGG - Intronic
974205191 4:58693477-58693499 ATGAAGAAACAGAAAACCTCAGG + Intergenic
974235076 4:59170348-59170370 CTGAAGAGACAGAGAGAAACAGG + Intergenic
974272273 4:59665895-59665917 TTGAGAAAACAGAAAGTGTCAGG + Intergenic
974656404 4:64829120-64829142 CTGAAAAAACAGAGACATTCAGG - Intergenic
975443132 4:74435565-74435587 CTCATGATATAGAAAGAGTCAGG + Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977914694 4:102578390-102578412 CTGAAGGAACTGAATGACTCAGG - Intronic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980526656 4:133997184-133997206 CTCAAGTAAAAGGAAGAGTCAGG + Intergenic
980985502 4:139690963-139690985 CAGAAGAACTGGAAAGAGTCTGG - Intronic
981147513 4:141342786-141342808 CTGCAATAAAAGAAAGAGTCTGG + Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981595793 4:146420335-146420357 TTCAAGAAACATAAAGAGACTGG - Intronic
982135734 4:152272468-152272490 GGGAAGAAACATACAGAGTCTGG - Intergenic
982250338 4:153399863-153399885 CTGAAAAAACAGAAAATTTCAGG - Intronic
982740839 4:159055280-159055302 CAGAAGAAAAGAAAAGAGTCAGG - Intergenic
983057806 4:163119381-163119403 CTGAAGACAGAAAAAGAGGCTGG - Intronic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
983808604 4:172027519-172027541 CTGAAGAGAGAGAGAGAGACAGG - Intronic
984041021 4:174733837-174733859 CAGAAGAAACAGGGAGACTCAGG - Intronic
984366757 4:178808644-178808666 CAAAAGAAACACTAAGAGTCGGG - Intergenic
984813948 4:183820087-183820109 CTTAAAAAAAAGAAAAAGTCAGG - Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
987530222 5:19108974-19108996 CTGAGGAAAAAAAAAAAGTCTGG - Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988413066 5:30911823-30911845 CTGAAGAAAAATACAGAGTGAGG - Intergenic
989235354 5:39141907-39141929 CTGGAGAAAAGGAAGGAGTCAGG - Intronic
990155832 5:52876426-52876448 CTTAGGAACCAGAAAGAGTAAGG - Intronic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
991223278 5:64240712-64240734 CAGAAGAAACAGTAAGTGTTTGG - Intronic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
994102165 5:95905438-95905460 CTGGAGAAGCAGTGAGAGTCAGG - Intronic
994410308 5:99399852-99399874 ATGAAGAAACAGAAATAGCTTGG - Intergenic
994483512 5:100365424-100365446 ATGAAGAAACAGAAATAGCTTGG + Intergenic
994551792 5:101243004-101243026 CTCAATCAACAGAAAGAATCAGG + Intergenic
996729940 5:126707088-126707110 CTGAAGAAACAGCCACTGTCTGG - Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
997584665 5:135037271-135037293 CTGAAGCAGCAGGCAGAGTCCGG - Intronic
998057876 5:139094752-139094774 CTAGTGAAACATAAAGAGTCTGG - Intronic
998172906 5:139882899-139882921 CTGAGGAACAAGAAAGAGGCAGG + Intronic
998896568 5:146806495-146806517 ATGAAGGAATGGAAAGAGTCAGG - Intronic
999062625 5:148652957-148652979 CTGAAAACAAGGAAAGAGTCAGG - Intronic
1000814191 5:165899918-165899940 CTGAAAATAAAGAATGAGTCCGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001469427 5:171999712-171999734 CAGAAGAAAAAGAAAGACTGAGG - Intronic
1001748044 5:174107288-174107310 GGGAAGAAAGAGACAGAGTCAGG - Intronic
1002276649 5:178108334-178108356 GCAAAGAAACAGAAAAAGTCCGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003774460 6:9344418-9344440 CTGCAGAAAAAGAAAAAGTAAGG + Intergenic
1004620342 6:17325765-17325787 CAGAAGAAAAGGAAAGAGTGTGG - Intergenic
1005200707 6:23341220-23341242 CCAAAGAAACATAAGGAGTCAGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005441586 6:25874971-25874993 CACAAGAAACTGAAAGAGTTTGG - Intronic
1005829267 6:29657482-29657504 CTCAAAAAAAAAAAAGAGTCTGG - Intronic
1005972595 6:30773116-30773138 TAGAAGGAACAGAAAGAATCAGG + Intergenic
1005973609 6:30780350-30780372 CTGAAAAAAGAAAAAAAGTCAGG + Intergenic
1006498876 6:34444562-34444584 CTGAAAATACAAAAAGTGTCTGG + Intergenic
1006565058 6:34949001-34949023 ATGAGGAAACAGACACAGTCAGG - Intronic
1007040186 6:38714920-38714942 CTGATGAGAGAGAAAGATTCTGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007625216 6:43242750-43242772 AGGAAGAAACTGAAAGAGACAGG + Intergenic
1008418569 6:51271350-51271372 CAGAAGCAACAGAGAGAGTGTGG - Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009474459 6:64071968-64071990 TTGAAGAAACATATAGAGCCGGG + Intronic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010963004 6:82168539-82168561 CTGAAGAAAAAGAAAAATTTAGG + Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1012107401 6:95180731-95180753 CTGTAGAAACTGATAGTGTCAGG + Intergenic
1012153948 6:95793066-95793088 TTGAAGAAAAAGAAAGAAACAGG + Intergenic
1013289129 6:108705803-108705825 CTGAAGAAATAGAAAAATCCTGG - Intergenic
1013350528 6:109301795-109301817 CTGAAGAAAAGGCAAGAGGCAGG + Intergenic
1013548496 6:111183830-111183852 CTGAAAAATCTCAAAGAGTCTGG + Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1014988846 6:128048582-128048604 TTGAAGAAAAATAAAGGGTCTGG - Intronic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1017359623 6:153552359-153552381 GTGGAGAAAAACAAAGAGTCTGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018297863 6:162368352-162368374 CTGTAGTAATACAAAGAGTCTGG - Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020250010 7:6460032-6460054 CTCAAAAAAAAGAAAGAGCCAGG - Intronic
1021195342 7:17668072-17668094 TTGAAGAAAGAGAAATAGCCAGG + Intergenic
1022036014 7:26535328-26535350 CTGAGGAAACACATAGAGGCAGG + Exonic
1022224840 7:28352539-28352561 CTGAGCAAAAAGAAAGAATCAGG - Intronic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1022613946 7:31909209-31909231 CTCAAGAAACACACAGGGTCTGG + Intronic
1022831515 7:34072186-34072208 CTGAAAATACAGAAAGCATCTGG + Intronic
1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG + Intergenic
1023507943 7:40919853-40919875 GTGAAGAATCAGGAGGAGTCAGG - Intergenic
1024800423 7:53071496-53071518 CTGTAGGAAAAGAAAGAGTAGGG - Intergenic
1024862106 7:53856762-53856784 CTGAAGAAATACAATGAGGCTGG - Intergenic
1024947974 7:54831022-54831044 CTGAAGGATAAGAAAGACTCGGG - Intergenic
1026497033 7:70912332-70912354 CAGAAGAAAGAGAAAGAATGAGG + Intergenic
1026629078 7:72021956-72021978 CTGAAGAAACAGAAGAGGTGAGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027174779 7:75896409-75896431 CTGCAGAATGAGAAAGAGTGAGG + Intergenic
1027576244 7:79934674-79934696 ATAAAAAGACAGAAAGAGTCTGG + Intergenic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1029127318 7:98303566-98303588 CTGAAGAGGCAGGCAGAGTCCGG + Intronic
1029240376 7:99157151-99157173 CAGAAGAAACAGTCAGAATCGGG - Intergenic
1030682372 7:112447598-112447620 CTGAAGAAAAAGGCAAAGTCTGG + Intronic
1030757011 7:113298978-113299000 TAGAAGAAACAGAAAGTGTCAGG + Intergenic
1030786111 7:113664040-113664062 CTGAAGAAAAAAAAGTAGTCAGG - Intergenic
1030829773 7:114206995-114207017 CTATAGAAACAGAAAGAATAAGG - Intronic
1030908933 7:115222721-115222743 ATGAAGACAGAGAAAGAGCCTGG + Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031554851 7:123161624-123161646 GAGAAGAGATAGAAAGAGTCAGG + Intronic
1031616066 7:123881461-123881483 CTCAAGAAACATAAAGAATAAGG + Intergenic
1031934327 7:127720602-127720624 CAGAAGAAAAAGAACTAGTCTGG - Intronic
1032154903 7:129459673-129459695 CAGAAGGTCCAGAAAGAGTCTGG - Intronic
1032928289 7:136635181-136635203 CTGATGAAACATAAATAGGCTGG + Intergenic
1033225337 7:139557977-139557999 CTCAAGAAACAAAAGGAATCTGG - Intergenic
1034270034 7:149798970-149798992 CAAAAGACACAGAAACAGTCCGG - Intergenic
1034270076 7:149799486-149799508 CAAAAGACACAGAAACAGTCCGG + Intergenic
1034469731 7:151248795-151248817 CTGATAAGACAGAAATAGTCCGG + Exonic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035533919 8:376742-376764 CAGCAGAAACAGAGAGTGTCTGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037217632 8:16477052-16477074 CTGAAGTAAAACAAAGAATCAGG - Intronic
1037218814 8:16490867-16490889 CGGAAGAAACACACAGAGACAGG + Intronic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1037893877 8:22639026-22639048 CTAAAGGAACGGAAAGACTCTGG + Intronic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039118766 8:34122243-34122265 CTGAAGAAGACAAAAGAGTCTGG + Intergenic
1039646584 8:39290849-39290871 CTGTAGAAACAGAGACAGTTAGG + Intergenic
1039818513 8:41115782-41115804 CTGGAGAAAGAGCAAGAGTGGGG - Intergenic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041100322 8:54390579-54390601 AAAAAGAAAAAGAAAGAGTCGGG - Intergenic
1041124793 8:54624701-54624723 CAGAAGAAACAGAATAAATCTGG - Exonic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043553669 8:81404476-81404498 CTGCAGACATAGAAAGAGACAGG + Intergenic
1043576377 8:81663444-81663466 TTGAAGAAACAGAAATGATCTGG + Intronic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044077063 8:87834909-87834931 TTGAAGAAAATGAAAGAGTTGGG - Intergenic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1046892563 8:119438921-119438943 CTGATGACAGAGAAAGAGACAGG + Intergenic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047033733 8:120912511-120912533 CTAATGAAAGAGAAAGAGTTTGG - Intergenic
1047789130 8:128184725-128184747 CTGAAAAAGCATAAAGTGTCTGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047989326 8:130269216-130269238 CTTAAGAAAAAGGCAGAGTCTGG + Intronic
1048256583 8:132909464-132909486 CTGAAGACAGAGATAGGGTCAGG + Intronic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1048654192 8:136517232-136517254 CTGAGGAAACAGCATGAGTCTGG - Intergenic
1048802899 8:138210563-138210585 CAGAAGAGACAGAGAGAGTAAGG + Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049973073 9:838398-838420 CTCAAGAAAAAAAAAAAGTCTGG - Intergenic
1050649735 9:7763107-7763129 CTGAAGAAACGGAGAGACACAGG - Intergenic
1051677894 9:19577023-19577045 CTGAAGCAAAAGAAAGTGGCAGG + Intronic
1052269224 9:26608969-26608991 CCAAAGAAACAGGAAAAGTCTGG - Intergenic
1052473565 9:28930228-28930250 CTGAAGGATAAGAAAGAGTGTGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1055277902 9:74640610-74640632 AAGAAGATACAGAAAGAGTTTGG + Intronic
1055670834 9:78604773-78604795 CTGAAAACGCAGACAGAGTCAGG - Intergenic
1056323111 9:85455449-85455471 CCTAAGGAACAGATAGAGTCTGG - Intergenic
1056804502 9:89718205-89718227 CAGAAAAATCAGAAAGAGTTTGG + Intergenic
1057477113 9:95412124-95412146 GTGAAGGAAGAGAAAGAGGCAGG + Intergenic
1057601272 9:96459637-96459659 GTCAAGAAGCAGAAAGAGTTTGG - Intronic
1057968497 9:99529660-99529682 CTTAGGATACGGAAAGAGTCAGG + Intergenic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1058588580 9:106536548-106536570 CTGAAGAAATAGAGAAGGTCAGG - Intergenic
1058647105 9:107140923-107140945 CTCAAGAAAAACAAAAAGTCAGG + Intergenic
1058747437 9:108005571-108005593 CTGAAGAAACAGGAAGGATGAGG + Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059226783 9:112680163-112680185 CTGAAGCTAATGAAAGAGTCAGG + Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059642761 9:116233884-116233906 CTGAAGAAAAAAAAAGAATGTGG + Intronic
1059746364 9:117205598-117205620 GTGGACAAACAGAAAAAGTCGGG - Intronic
1060077006 9:120600396-120600418 TTGAAAAAAAAGAAAAAGTCAGG - Intergenic
1061179511 9:129015701-129015723 GTGAAGAAACAATAAGAGGCTGG + Intronic
1061624436 9:131833448-131833470 CTGAGGGAACAAAAAGAGGCTGG - Intergenic
1062514823 9:136927527-136927549 CTGAAGACACGGGAAGAGACTGG - Intronic
1185681772 X:1894216-1894238 AGGAAGACACAGAAAGAGACAGG - Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186039697 X:5462372-5462394 CTGAGGTTACAGAAAGAGTGGGG + Intergenic
1186102914 X:6175835-6175857 CTGAGGTTACAGAAAGAGTGGGG - Intronic
1186295081 X:8140652-8140674 CTGAGGTTACAGAAAGAGTGGGG + Intergenic
1186908082 X:14132722-14132744 TTGAAGAAACAGAACGATTCTGG - Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1188007990 X:25030297-25030319 CTTAAGAAAGAGAAGGATTCTGG - Intergenic
1189018999 X:37315152-37315174 CTGAAACAAAAGAAAGATTCAGG + Intergenic
1189215181 X:39316914-39316936 CTGAAGTAACAGAAATAAACTGG + Intergenic
1189530526 X:41877167-41877189 TTGAAGAAACAGAGAGGGACGGG - Intronic
1189685958 X:43563778-43563800 CTTATGAAACAGAATGAGTCTGG - Intergenic
1189760733 X:44319162-44319184 CTGAAAATACAAAAAGAGCCAGG - Intronic
1189966232 X:46376698-46376720 TTAAAGAAACAGAAAGACCCGGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190405661 X:50084886-50084908 ATCAAGAGACAGAAAGAATCGGG - Intronic
1190409559 X:50122535-50122557 CTTCAGAAAAAGAAAGATTCAGG - Intergenic
1190711682 X:53076200-53076222 AGGAAGAAACAGAAAGGGTAGGG - Intronic
1190936639 X:55003900-55003922 CTGGACAAACAGAATCAGTCAGG - Intronic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194390995 X:93317963-93317985 GAGAAGAGATAGAAAGAGTCAGG - Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1195876690 X:109549929-109549951 CTCAAAAAAAAAAAAGAGTCAGG - Intergenic
1195919471 X:109968284-109968306 CTAAAGAAACAGAACCAGTAGGG - Intergenic
1196038837 X:111178397-111178419 TTGAAGAAAAAGAAAGAGACAGG + Intronic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1198365194 X:135932971-135932993 CTGAAGAACCTGCAATAGTCTGG + Intergenic
1198434303 X:136600442-136600464 TTGAAGAAATAGAATGAGTGGGG - Intergenic
1198666358 X:139027767-139027789 ATAAAGAAACAGAAAAATTCAGG + Intronic
1198914449 X:141652447-141652469 CTCAGGAAACAAAAAGAGGCAGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199295731 X:146156130-146156152 AGGAAGATACAGAGAGAGTCTGG - Intergenic
1199494578 X:148438889-148438911 CTGGAGAAACAGGCAGGGTCAGG + Intergenic
1199533180 X:148872309-148872331 CTGTAGAGACTGAAAGAGACTGG - Intronic
1200154333 X:153967352-153967374 CTGATGAAACACAGAGAGGCCGG - Intronic